ID: 1033174670

View in Genome Browser
Species Human (GRCh38)
Location 7:139113166-139113188
Sequence ATCCCACTGGACTACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033174670_1033174675 14 Left 1033174670 7:139113166-139113188 CCATCACAGTAGTCCAGTGGGAT No data
Right 1033174675 7:139113203-139113225 CAGGCAAGAGTGTGCCCCTTTGG No data
1033174670_1033174673 -5 Left 1033174670 7:139113166-139113188 CCATCACAGTAGTCCAGTGGGAT No data
Right 1033174673 7:139113184-139113206 GGGATCTCTGTGGTATCTCCAGG No data
1033174670_1033174677 16 Left 1033174670 7:139113166-139113188 CCATCACAGTAGTCCAGTGGGAT No data
Right 1033174677 7:139113205-139113227 GGCAAGAGTGTGCCCCTTTGGGG No data
1033174670_1033174676 15 Left 1033174670 7:139113166-139113188 CCATCACAGTAGTCCAGTGGGAT No data
Right 1033174676 7:139113204-139113226 AGGCAAGAGTGTGCCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033174670 Original CRISPR ATCCCACTGGACTACTGTGA TGG (reversed) Intergenic
No off target data available for this crispr