ID: 1033175314

View in Genome Browser
Species Human (GRCh38)
Location 7:139118434-139118456
Sequence CAGGTGTTCTACAGGAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033175309_1033175314 -6 Left 1033175309 7:139118417-139118439 CCGAAGTCCCTGCCAAACAGGTG No data
Right 1033175314 7:139118434-139118456 CAGGTGTTCTACAGGAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033175314 Original CRISPR CAGGTGTTCTACAGGAGATA TGG Intergenic
No off target data available for this crispr