ID: 1033180130

View in Genome Browser
Species Human (GRCh38)
Location 7:139168985-139169007
Sequence CTGTTCCAAGGTCTGATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033180127_1033180130 -3 Left 1033180127 7:139168965-139168987 CCTTGTTATATCTACAGCTCCTG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1033180130 7:139168985-139169007 CTGTTCCAAGGTCTGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033180130 Original CRISPR CTGTTCCAAGGTCTGATATA TGG Intronic
No off target data available for this crispr