ID: 1033180561

View in Genome Browser
Species Human (GRCh38)
Location 7:139173609-139173631
Sequence CTTTTTAAGGAGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 3, 2: 5, 3: 50, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033180561_1033180566 -2 Left 1033180561 7:139173609-139173631 CCATCCACCATCTCCTTAAAAAG 0: 1
1: 3
2: 5
3: 50
4: 377
Right 1033180566 7:139173630-139173652 AGGTCAACATTCTTTTCTTCTGG 0: 1
1: 0
2: 3
3: 26
4: 269
1033180561_1033180568 21 Left 1033180561 7:139173609-139173631 CCATCCACCATCTCCTTAAAAAG 0: 1
1: 3
2: 5
3: 50
4: 377
Right 1033180568 7:139173653-139173675 GATATAATGCACGTTCATATTGG 0: 1
1: 1
2: 0
3: 3
4: 74
1033180561_1033180569 28 Left 1033180561 7:139173609-139173631 CCATCCACCATCTCCTTAAAAAG 0: 1
1: 3
2: 5
3: 50
4: 377
Right 1033180569 7:139173660-139173682 TGCACGTTCATATTGGCATGTGG 0: 1
1: 1
2: 0
3: 6
4: 60
1033180561_1033180567 -1 Left 1033180561 7:139173609-139173631 CCATCCACCATCTCCTTAAAAAG 0: 1
1: 3
2: 5
3: 50
4: 377
Right 1033180567 7:139173631-139173653 GGTCAACATTCTTTTCTTCTGGG 0: 1
1: 0
2: 4
3: 33
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033180561 Original CRISPR CTTTTTAAGGAGATGGTGGA TGG (reversed) Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901564235 1:10099379-10099401 CTTTTTAATGAAATTGTGAATGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902960117 1:19957371-19957393 TTCTTTAAGGAGGTAGTGGAGGG + Intergenic
903089557 1:20899606-20899628 CTTTTTAGAGAGATACTGGATGG - Intronic
903794157 1:25915793-25915815 TTTTTTAATGAGATGGGGAAAGG + Intergenic
904345926 1:29869452-29869474 CTTTCTAAGGATATGGAGGGTGG - Intergenic
906135344 1:43495837-43495859 GTTTTTGAGGAGAAGGTGAATGG - Intergenic
906404263 1:45529062-45529084 TTTTTTGTGGAGATGGTGAAGGG - Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908334960 1:63112570-63112592 CTTTTTAATGTGATGCTGCATGG - Intergenic
908590732 1:65630190-65630212 CTTTTTAAACAGATGCTTGAAGG + Intronic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
912988767 1:114461720-114461742 CTTTTTAAGTTGATGGTGAGAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
915919417 1:159963018-159963040 ATTTAGAAGGAGATGGTGGGTGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917678684 1:177344309-177344331 CATTTTGAGGAGTTCGTGGAGGG + Intergenic
917939280 1:179901981-179902003 AATTTTAAGGAGGTGGTGAAGGG - Intronic
918116003 1:181498203-181498225 CTTTTTAAGGAAATGAGGGTTGG + Intronic
919353107 1:196485139-196485161 CTTTTTAGGGACATGGATGAAGG + Intronic
919570388 1:199241985-199242007 TTTTTTAAGGTGATGGGGTAGGG - Intergenic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
921825071 1:219663346-219663368 CTTTTTAAAGGGGTGGTGGCTGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
923430121 1:233911897-233911919 CTTTTTAATGAGATCCAGGAGGG - Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1063874694 10:10461835-10461857 CTTTTTTTGGGGATGGTGGGAGG - Intergenic
1063879660 10:10518023-10518045 GGTTTCAAGGAGATGGTGGGTGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1067932321 10:50575308-50575330 CTTTATAAGGCTATGGTGGGTGG + Intronic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068283027 10:54901139-54901161 TTTTTTGTAGAGATGGTGGAGGG - Intronic
1069943388 10:71970253-71970275 CTTTGTGAGGAGGTGGTGGGGGG - Intronic
1070393678 10:75993037-75993059 CTTTTATTGGAGCTGGTGGAAGG + Intronic
1071080959 10:81810551-81810573 CTTTTTAAAGAAATCATGGAAGG - Intergenic
1071097388 10:81993588-81993610 CTTTGTGAGGACATGGTGGGAGG - Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071836885 10:89427076-89427098 CATTTTTAAGAGATGGTGAAAGG - Intergenic
1072869750 10:99104755-99104777 CTTTGTAAGGACATGGCTGAAGG + Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1074133719 10:110608608-110608630 TTTTTTAAGTAGATGGGGGTGGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1075036298 10:119071117-119071139 ATATTTAAGTAGATAGTGGAAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1078477683 11:11645713-11645735 CTCTTTAAGCAAATGGGGGATGG - Intergenic
1078673039 11:13381961-13381983 CTGTTTTAGGAGATGGGGAAAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1079664984 11:23093672-23093694 ATGTTTAAGGAAATGGTGGGTGG - Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081263263 11:40987211-40987233 CTTTTTATGGACATGGTCAAGGG - Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083861139 11:65420847-65420869 CTTTTGAAGGCCATGGTGGGAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1086253938 11:84851631-84851653 CTTTTTGGGGAGTTGATGGAGGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086846444 11:91755582-91755604 CTAGTTAAGGTGATGCTGGAGGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1088369904 11:109077700-109077722 CTCTTTCATGAGATGGTGGGAGG - Intergenic
1088577633 11:111287114-111287136 CTTTGGAAGGCCATGGTGGATGG - Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090522078 11:127490183-127490205 CTATTCATGGAGATGGGGGAAGG - Intergenic
1091700634 12:2658283-2658305 ATTTTTAAGTAGATTTTGGAGGG - Intronic
1092266112 12:6981749-6981771 GTTTTTAGTGAGATGGGGGAGGG + Intronic
1092778465 12:11964224-11964246 CTTTCTATGGACATGGTGTAAGG - Intergenic
1093113997 12:15187133-15187155 ATCTTTGAGGAGATGGTGGGAGG + Intronic
1094253239 12:28391054-28391076 CTTTTTAAGGAGAAGATGTGTGG + Intronic
1095342872 12:41112865-41112887 CCTTTTAAGGAGTTGCTGTAAGG + Intergenic
1096063452 12:48721106-48721128 CATTTTAAGTGGATGGTGGCAGG + Intergenic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1097760116 12:63454595-63454617 CATTTTAAGTTGATGGTGAATGG - Intergenic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1104263381 12:127206145-127206167 CTTTATAAAAACATGGTGGAGGG - Intergenic
1105276546 13:18933649-18933671 CTTTTTAAAGAGACTGTGGGTGG + Intergenic
1108059055 13:46515113-46515135 CTTTTTAAACAGATGCTTGAAGG - Intergenic
1108332450 13:49402897-49402919 CTTTTTAAAGAGATGTTAAATGG + Intronic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1109976833 13:69848031-69848053 CTATTTAAGGTGCTGGTGAAAGG + Intronic
1110907355 13:80908756-80908778 CTTTTTCAGAAGATGGAGAAAGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115334687 14:32233099-32233121 CTTTTCAGGGAGATGTAGGAAGG + Intergenic
1115954201 14:38759349-38759371 CATTTGAAGGAGGTGGAGGAGGG + Intergenic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1117698325 14:58388879-58388901 CCTTTTAAGGAAATGGTGCAGGG + Intergenic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1119149842 14:72348661-72348683 GTTTTAAAATAGATGGTGGATGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1120631294 14:86894587-86894609 ATTTTTAAGGAGATGGCCAAAGG - Intergenic
1120730085 14:87992499-87992521 CTTTTGGAGGAGTTGGTGGGTGG - Intronic
1120883772 14:89435631-89435653 CTTTTTACGGAGCTGTTGGCTGG - Intronic
1121281015 14:92698191-92698213 CTAATTAAATAGATGGTGGATGG + Intergenic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1123154956 14:106215815-106215837 CATTTTCAGAAGATTGTGGATGG - Intergenic
1123181472 14:106475221-106475243 CATTTTCAGAAGATTGTGGATGG - Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128789286 15:70421075-70421097 CTATTTAAGGAGATGAAAGAAGG - Intergenic
1128871134 15:71156024-71156046 CTTGTTCAGGCAATGGTGGATGG - Intronic
1129168724 15:73794789-73794811 ATTTTTAAGCAGATGTTGTAGGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130072225 15:80657359-80657381 CTTTTTAAAGAAATGGCAGATGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1130843853 15:87726045-87726067 TTGATTAGGGAGATGGTGGAGGG + Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1135042093 16:19125452-19125474 CTTTTTGAGGCCAAGGTGGACGG - Intronic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139869345 16:70092503-70092525 CTTTTTTGGGAGATGGAGGGAGG + Intergenic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140386038 16:74539710-74539732 CTTTTTTGGGAGATGGAGGGAGG - Intronic
1140687655 16:77449049-77449071 CTTTTTAAACAAATGGTAGAGGG + Intergenic
1140898425 16:79346588-79346610 ATTTTGAAGGTGATGATGGATGG + Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1141972772 16:87494089-87494111 CTTTTTCAGGATATGGTCCAAGG + Intergenic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1142509379 17:384928-384950 GTTTTTCAGGAGATGGGAGATGG + Intronic
1142564710 17:832495-832517 ATTTTTAAGGAAATGGTGGTGGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1146419425 17:32669200-32669222 CTTTTCAGGGAGATAGGGGAAGG - Intronic
1146438738 17:32876056-32876078 TTTTTCAAGGAGTTAGTGGATGG - Intronic
1147361332 17:39932540-39932562 TTTTTTATAGAGATGGTGGTTGG - Intergenic
1148217038 17:45838980-45839002 CATTTTAAGGAGCTGGGGGGTGG - Intergenic
1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG + Intronic
1148737674 17:49874018-49874040 CTTTTTATGGAGATGGAGGTGGG - Intergenic
1150695615 17:67402509-67402531 CTTTGTCAGGAAATGGCGGAGGG - Intronic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1153320161 18:3765043-3765065 CTGTTTATGTAGGTGGTGGATGG + Intronic
1153562535 18:6385559-6385581 CTTTGAATGGAGATGGTGGTAGG - Intronic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1154947718 18:21178613-21178635 CTTTTTAATGTTCTGGTGGAAGG + Intergenic
1155021178 18:21898256-21898278 CTTTGAAAGGAGGTGGTGGCAGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155859344 18:30877395-30877417 CTATTTAGGGAGAGAGTGGATGG + Intergenic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1158253790 18:55521633-55521655 CTTTTTAGAGCAATGGTGGATGG - Intronic
1158457866 18:57623287-57623309 ATTTTTGTGGAGATGGGGGAGGG + Intergenic
1158720198 18:59917757-59917779 CTTTTTAATGAGCAGGTGAAGGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1158990752 18:62866124-62866146 CCTTTTAGGGAGACGGGGGATGG + Intronic
1159153744 18:64555150-64555172 CTTTTTAAGGATTTTTTGGATGG + Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1160631531 18:80249774-80249796 CTTTTAAAGGAAAGGCTGGAAGG + Intergenic
1161638299 19:5403236-5403258 TTTTTTGTAGAGATGGTGGAGGG + Intergenic
1163070939 19:14840860-14840882 TTTGTTAATAAGATGGTGGAAGG - Intergenic
1164882943 19:31751143-31751165 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1165978631 19:39700178-39700200 CTTTTTATGGAAATTGTGAATGG - Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1168324012 19:55529081-55529103 CTTTTTAAAAAGATGGTTGGGGG - Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
926389687 2:12376330-12376352 CTTTTTAAGGAGATAATGCTTGG - Intergenic
926615451 2:14992564-14992586 CATTTTCAGGAGATGGTTCAGGG + Intergenic
926720412 2:15956224-15956246 CATTTTAATGAGATGTTTGAGGG - Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
928247095 2:29640007-29640029 TTTTTTAAACATATGGTGGAGGG + Intronic
929174836 2:38966121-38966143 CTTTTTAAAGAGCTTGCGGAAGG - Exonic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929943932 2:46356309-46356331 CTTTTGAAAGAGATAGAGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933056846 2:77681125-77681147 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
933698988 2:85241002-85241024 GTTTTTAAGGAAATGGAGAAAGG + Intronic
933926979 2:87102269-87102291 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936649049 2:114405466-114405488 CGTTTCCAGGAGATTGTGGATGG - Intergenic
936662316 2:114556031-114556053 AGTTTTAAGGAGATGGCAGAAGG + Intronic
936896483 2:117433565-117433587 GTTTGTAAGAAGATGGTGAATGG + Intergenic
939215075 2:139226454-139226476 CTTTTTAAGGACACAGGGGATGG + Intergenic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
939434802 2:142161591-142161613 CTTTTTATGGAAATTGTGAATGG - Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
940129575 2:150365614-150365636 CTTCTTCAGGAGAAGGTGTAAGG - Intergenic
942198674 2:173549096-173549118 CTTTAAAAGGATTTGGTGGAAGG + Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
944088239 2:195874312-195874334 CAGTTTAAGGAGATGGTGAAAGG + Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
946220084 2:218218020-218218042 CTTTTAAAGGAGATGGGGGTGGG - Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947573529 2:231254007-231254029 CATTTTGAGGTGATGTTGGATGG + Intronic
947914430 2:233822373-233822395 CTTCTGAATGAGAAGGTGGATGG - Exonic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947929652 2:233953016-233953038 ATTTTGAAGGAGAGGGTGGGTGG - Intronic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948578020 2:238966519-238966541 CTTTTAAAGGGGATGGCAGAGGG + Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1169963267 20:11186972-11186994 ATTTTTAAAGAGTTGGAGGAAGG - Intergenic
1170446010 20:16428560-16428582 CTTTTGAAGGAGAGGGTTGTAGG - Intronic
1171002774 20:21431299-21431321 CTTTTAAAAGAGTTGGTGGCCGG - Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1173960380 20:47066794-47066816 CCTCTTAAGGTGATGGTGGCAGG - Intronic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1175146195 20:56898006-56898028 CTCTTTCTGGTGATGGTGGAGGG + Intergenic
1177871207 21:26574935-26574957 CTTCTTTAGAACATGGTGGATGG - Intergenic
1178117522 21:29432650-29432672 CTTTTTCAGGAAATGGAGCAAGG - Intronic
1179141851 21:38732669-38732691 TTTGCCAAGGAGATGGTGGAAGG - Intergenic
1179633317 21:42691954-42691976 CTTTGGATGGAGATGGTGAAGGG - Intronic
1181368261 22:22396857-22396879 CTTTTTGAGGAGCGGGTGGTTGG - Intergenic
1181376132 22:22459711-22459733 CTTTTTGAGGAGTAGGTGGGTGG - Intergenic
1181609791 22:24004705-24004727 CTTTTCGAGGAGAAGGGGGAAGG - Intergenic
1181687118 22:24537034-24537056 CTTTTTTTGGTGGTGGTGGAAGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182506957 22:30790293-30790315 CTTTTTAAGGAGGGGGGGGCGGG + Intronic
1183012372 22:34957377-34957399 CTTTTTATGAAGATGGTGTCTGG - Intergenic
1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG + Intergenic
1183756909 22:39775901-39775923 CTTTTTAAGGGGTTGGGGGCAGG + Intronic
949104024 3:181834-181856 CTTATCAAGGAGATGAGGGAAGG - Intergenic
949538267 3:5012358-5012380 CTTTTTAGGAAGATGGTGTGGGG - Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
951301306 3:21000459-21000481 GTTGTTGTGGAGATGGTGGATGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
953344263 3:42161810-42161832 GTCTTGAAGGAGATGGGGGAGGG + Intronic
953775317 3:45811825-45811847 CTTTGGAAGGAGATGGTGCCTGG + Intergenic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
955911270 3:63862736-63862758 GTTTTTCAGGAGATGGTGACCGG - Intronic
955993155 3:64650210-64650232 CTTTTTAACCAGATGGTGTAAGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
958028600 3:88078780-88078802 ATTCTTAGGGAGATGGGGGATGG + Intronic
959077688 3:101766948-101766970 TTTTTTAAAGAGATGGAGGCTGG + Exonic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960279705 3:115767508-115767530 CTTTTGAAGGAGAAAGTGAAAGG + Intergenic
960803999 3:121565196-121565218 ATTTTGAGGGAGATGGTGGCAGG + Intergenic
961142958 3:124570896-124570918 CTTGTCAAGGACATTGTGGAAGG - Intronic
961336465 3:126182857-126182879 CTCATTAAGGAGATTGTTGAAGG + Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969338428 4:6525704-6525726 CTTTTTGGGGGGATGGGGGAGGG + Intronic
970722786 4:19007524-19007546 GTTTTTAGGGAGGTGGAGGAAGG - Intergenic
970895560 4:21099455-21099477 CTTGTCAAGGAGGTGGGGGAAGG + Intronic
970961816 4:21880138-21880160 CTTTTTAAGGAGATATGGCATGG + Intronic
971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG + Intronic
973052198 4:45610097-45610119 CTCTTTAAGGATAATGTGGACGG - Intergenic
973661914 4:53116819-53116841 GTTTTGAGGGAGATGGTAGAAGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978765716 4:112403041-112403063 CTTTTTTAGGGGGTGGGGGAGGG + Intronic
979006091 4:115299004-115299026 CTTTTGAAGGCCAAGGTGGAAGG - Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG + Intergenic
986983314 5:13473994-13474016 CTTTTTACGTGGATGGTGGCCGG - Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
989427460 5:41313211-41313233 CTTTTTAATCAGATGCTGTATGG - Exonic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990849631 5:60188242-60188264 CTCTTTAAGGAGATGTTGGTAGG + Intronic
992981535 5:82179657-82179679 ATTTTTAAGGAGATGATGATTGG - Intronic
994879738 5:105474369-105474391 ATTTTAAAGGAAATGGTTGAAGG + Intergenic
995641903 5:114266828-114266850 CTTTACAAGGAGATGCTGGTGGG - Intergenic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
995820192 5:116221276-116221298 GATTTTAAGGAGATAGTAGAGGG - Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996552864 5:124748030-124748052 TTTTTTAAGGAGATGGCGAATGG + Intronic
997045475 5:130311762-130311784 ATTTTTAAGGTATTGGTGGATGG - Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998675851 5:144407046-144407068 CTTTTAATGAAGCTGGTGGAGGG + Intronic
999941769 5:156550832-156550854 TTTTTAAAGGAGATAGTGAAGGG + Intronic
1000384931 5:160666191-160666213 GTTTTCAAGGAGGTGGTGGTAGG + Intronic
1001467465 5:171981017-171981039 CTTTTCCCGGAGATGGTGGTGGG - Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002521304 5:179794490-179794512 CTTTTTAGGGGGCTGGAGGAAGG - Intronic
1003266332 6:4567898-4567920 CTTTTTTGGGAGATGGATGAGGG + Intergenic
1003628355 6:7764288-7764310 CTTTTTCTGGAGGTGGTGGAAGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003961970 6:11217195-11217217 CTTTTGAATGAGATGGTTTATGG - Intronic
1004669908 6:17785980-17786002 CATTTTAGGGACATAGTGGATGG - Intronic
1005012100 6:21345915-21345937 CTTTTCAAGGACATGGATGAAGG + Intergenic
1005273088 6:24187155-24187177 TTTTTTAAGGAAATAGAGGAGGG - Intronic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1008652211 6:53575116-53575138 CATCTTGAGGAGATGGTGTACGG + Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1010081255 6:71866731-71866753 CTATTTAAGGAGGTGTTCGAGGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1012676398 6:102118451-102118473 CTTTTTTAGGAGATTGTAGCTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013576720 6:111490822-111490844 ATCTTTAAGGAGAAGGTAGAAGG + Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013653012 6:112215219-112215241 TTATTTAAGAAGATGGGGGAAGG + Intronic
1013929023 6:115507619-115507641 CTGTTAAAGGAAATGATGGAGGG - Intergenic
1014275572 6:119384547-119384569 TATTTTATGGAGATGGGGGAGGG + Intergenic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1014761734 6:125363962-125363984 CTCTTTCAGGAGAGGCTGGAGGG + Intergenic
1015145250 6:129977947-129977969 ATTTTGGGGGAGATGGTGGAGGG + Intergenic
1016441481 6:144088980-144089002 GTTTTTAGGGATATGGTGGGGGG - Intergenic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019981609 7:4625572-4625594 TTTTTTAAAGAGATGGGGGCTGG - Intergenic
1021478563 7:21090764-21090786 CTTTGTAGGGACATGGTTGAAGG + Intergenic
1022585583 7:31605527-31605549 CTTTTCAGGGACATGTTGGAAGG + Intronic
1024409725 7:49026413-49026435 CTTTTTAAGGAAATTTTGGCAGG - Intergenic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1029066141 7:97850459-97850481 CTTTTTAGGGACATGGATGAAGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1030649804 7:112105130-112105152 CTTTTCAAGGTGATGGTGACTGG - Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031461383 7:122053418-122053440 CACTTTAAGGAACTGGTGGATGG + Intronic
1031725551 7:125233564-125233586 CTTTTTAATGAAAGGGTGTAAGG - Intergenic
1032116590 7:129122865-129122887 CTTAGTAAGGAACTGGTGGAGGG + Intergenic
1032933614 7:136703103-136703125 CATTTTCAGTAAATGGTGGAGGG - Intergenic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034397300 7:150836813-150836835 CTTACTAAGGAGATGGAGCAAGG + Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1035616528 8:1006218-1006240 CTTTTTCAGGGGTTGGGGGATGG - Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1038097728 8:24334276-24334298 CTTGTAAAGTAGATGTTGGATGG + Intronic
1038539680 8:28381910-28381932 CTTTTTGAGGAGCTGCTGGCTGG - Intronic
1039353979 8:36795053-36795075 CTTTGCAAGGAGATGGGGCAGGG + Intronic
1040922392 8:52636821-52636843 CTTTTTCAGCAAATGGTGCAGGG - Intronic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041506714 8:58607260-58607282 CTTATTCAGGGAATGGTGGAAGG + Intronic
1041854371 8:62433941-62433963 CTTAATAAAGATATGGTGGATGG - Intronic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043245260 8:77991382-77991404 GTTTTTTCGGAGATGGTGGCAGG + Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1045892094 8:107169334-107169356 ATTTTGAAGGAGGTAGTGGAAGG + Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1046264865 8:111817514-111817536 CTTATAAAAGAGATGCTGGAGGG - Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1046774926 8:118153761-118153783 CTTTTGAAGGATATGGAGGAAGG - Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050282524 9:4066004-4066026 CATTTTAATGAGATGTTGGAAGG - Intronic
1050518725 9:6474253-6474275 GTTTTTAAAGAAAAGGTGGAAGG + Intronic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1051212430 9:14758658-14758680 CTTTTTCATCAGATGGTGGGGGG + Intronic
1051851461 9:21514098-21514120 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052918520 9:33943290-33943312 TTTCTTATGGAGATGATGGAAGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058326837 9:103708923-103708945 CATGTGAAGGAGATGTTGGATGG + Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1058664310 9:107296256-107296278 ATTTTTAAGGTGGTGGGGGAAGG - Intronic
1059275431 9:113092702-113092724 CTTTTAAAGGACAAGGTGGGTGG + Intergenic
1059522565 9:114957300-114957322 CTGGTTAAGGACATGGTGGCAGG + Intergenic
1061282178 9:129603731-129603753 TTTTTTAAAGAGATGGGGGGGGG + Intergenic
1062111654 9:134785313-134785335 CCTTCCAAGGCGATGGTGGAGGG - Intronic
1185762156 X:2696839-2696861 AGTTTTGAGGAGATGGTGCATGG + Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187416260 X:19095839-19095861 TTTTTTATTGAGATGGGGGAGGG - Intronic
1187509884 X:19908174-19908196 TTTTTTTAAGAGATGGTGGGGGG - Intergenic
1190381850 X:49846873-49846895 CCTGTTAGGGAGATGGTGCAGGG + Intergenic
1191673246 X:63768793-63768815 CATTTTAAGTGGATGGTGGCAGG - Intronic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195416031 X:104620341-104620363 TTTTTTAAAGAGATGGTGGCTGG + Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195953580 X:110305106-110305128 CTTTTTAAGGACATGAAGCATGG + Intronic
1196440079 X:115711506-115711528 CTTTTTGAGAAGCTGGTGAATGG - Intergenic
1196586077 X:117429499-117429521 CATACTAAGGAGATGGTGTATGG + Intergenic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1196981215 X:121215330-121215352 TTTCTTAAAGAGATGGTGGGAGG - Intergenic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1198039298 X:132834071-132834093 CTTTTTAGGGAGTGGGAGGATGG - Intronic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1198379535 X:136070849-136070871 CTATTTAAAGAGATGGCAGAAGG + Intergenic
1199699853 X:150366990-150367012 ATTTTTAAGGAGATCTTGTAAGG - Intronic
1200271012 X:154683485-154683507 CTTTTCTATGAGATGGGGGATGG + Intronic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic