ID: 1033182936

View in Genome Browser
Species Human (GRCh38)
Location 7:139198585-139198607
Sequence TTCATTCGATGTTATATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033182935_1033182936 -7 Left 1033182935 7:139198569-139198591 CCATAATCATCTGGCATTCATTC 0: 2
1: 0
2: 6
3: 34
4: 270
Right 1033182936 7:139198585-139198607 TTCATTCGATGTTATATCTATGG 0: 1
1: 0
2: 1
3: 10
4: 107
1033182933_1033182936 2 Left 1033182933 7:139198560-139198582 CCAAGGACTCCATAATCATCTGG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1033182936 7:139198585-139198607 TTCATTCGATGTTATATCTATGG 0: 1
1: 0
2: 1
3: 10
4: 107
1033182932_1033182936 3 Left 1033182932 7:139198559-139198581 CCCAAGGACTCCATAATCATCTG 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1033182936 7:139198585-139198607 TTCATTCGATGTTATATCTATGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033182936 Original CRISPR TTCATTCGATGTTATATCTA TGG Intergenic
906849344 1:49231168-49231190 TTGGTTCCATTTTATATCTAAGG + Intronic
906959200 1:50405461-50405483 TCCATTCAATGTTGTATCTATGG + Intergenic
907699239 1:56766988-56767010 TCTATTCCATGTTATATTTATGG + Intronic
908311155 1:62885705-62885727 TTCATTCCAGGTCATATCCAAGG - Intergenic
908313640 1:62910907-62910929 TTCATTCGTTTCTATATCTCTGG + Intergenic
911763745 1:101647711-101647733 ATCATTACATGTTATATATATGG - Intergenic
912267074 1:108168421-108168443 TTCATTCAAAGTTATAACCAAGG + Intronic
912418137 1:109525007-109525029 ATCAGTGGATGTTATAACTAGGG + Intergenic
915636033 1:157187252-157187274 TTAACTCGATGCTATATCTAGGG - Intergenic
917411687 1:174765786-174765808 TGCATTTGGTGTCATATCTAAGG + Intronic
918722352 1:187869042-187869064 TTTATTACATGTTATATCAAAGG + Intergenic
919412986 1:197269726-197269748 GTCATTCAATGTAATATATATGG + Intronic
920733053 1:208506139-208506161 TGCTTTTGATGTCATATCTAAGG - Intergenic
920949508 1:210559086-210559108 TTCATGCTCTGTGATATCTATGG - Intronic
921920265 1:220660822-220660844 TTCATTCACTGATATATCTCGGG - Intronic
923579635 1:235196038-235196060 TTCTTCCGATGTTTTATCTTTGG + Exonic
924789600 1:247232852-247232874 TTCATTCCTTGTTATGTCTGAGG - Intergenic
1063149671 10:3324878-3324900 TTCATTCGATTTTGTAGCTCGGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066088459 10:31994319-31994341 TTCATTTTATGTTATAACTATGG + Intergenic
1066787510 10:39021698-39021720 TTCTTTCTAGTTTATATCTAGGG + Intergenic
1066788310 10:39031241-39031263 TTCCTTCTATGTTTTATCTTGGG + Intergenic
1066794236 10:39101279-39101301 TTCATTCTAGTTTATATCTGGGG - Intergenic
1066931202 10:41761456-41761478 TTCATTCTAGGTTTTATCCAGGG - Intergenic
1067316107 10:45164679-45164701 TTCATTGGATGTTATAGGTTGGG + Intergenic
1067338413 10:45382080-45382102 TTCATTCAATGCAGTATCTAAGG - Intronic
1073093082 10:100960777-100960799 TTTTTTTGATGTTATATCTAAGG + Intronic
1082254157 11:50013965-50013987 TTTATTCCATTTTATATGTAAGG - Intergenic
1086010770 11:82100716-82100738 TTCATTTGATGTGTTTTCTATGG - Intergenic
1086920785 11:92583991-92584013 TTCAAGCGCTGTTCTATCTAAGG - Intronic
1087944274 11:104139335-104139357 TTCATTAGAAGTTATATCCCCGG - Intronic
1089035713 11:115388386-115388408 ATCAATAGATGTTAAATCTAAGG + Intronic
1094116057 12:26914509-26914531 TTCCATCGATTTTATATCTGGGG + Exonic
1096249358 12:50018480-50018502 TTCATTATATGTTAAATCCATGG - Intronic
1099042473 12:77673439-77673461 TTCTTTTAATATTATATCTAAGG + Intergenic
1099478853 12:83141359-83141381 TTCATTCAGATTTATATCTATGG - Intergenic
1100684001 12:96965675-96965697 TGCTTTTGATGTCATATCTAAGG - Intergenic
1105046346 12:133007050-133007072 GTCATTCAAGGATATATCTATGG + Exonic
1117387194 14:55227596-55227618 TTTACTGGAGGTTATATCTAGGG + Intergenic
1127521712 15:59749537-59749559 TTCATTACATGTGATATCTGGGG - Intergenic
1127702898 15:61518545-61518567 TTCATTTTATATTATGTCTAGGG + Intergenic
1137086395 16:36129623-36129645 TTCATTCGTTGATATTTCCATGG + Intergenic
1138823596 16:60291253-60291275 TTCATTTGAAGTTACATCGATGG + Intergenic
1140992654 16:80229212-80229234 TTCACTCAATGTTATGTCTGTGG + Intergenic
1143092908 17:4459739-4459761 TTTATTCACTGCTATATCTACGG - Intronic
1156557979 18:38089022-38089044 TTAATCCTATGTTAAATCTATGG + Intergenic
1157210962 18:45741549-45741571 TTGATTCGATGCTATAGCAAGGG + Intronic
1164369207 19:27627479-27627501 TTCTTTCTAGTTTATATCTAGGG - Intergenic
1164831713 19:31327110-31327132 TTAATTCTATGTTTTTTCTAAGG - Intronic
926510388 2:13769859-13769881 TGCATTTGTTGTCATATCTAAGG + Intergenic
926926267 2:17991144-17991166 TGCTTTCGATGGTGTATCTAAGG + Intronic
931014132 2:57955912-57955934 TGCATTAGATGTTATAAATAAGG + Intronic
936843115 2:116797880-116797902 TTCAATCGGTGTTATTTCTTTGG - Intergenic
938709567 2:133964493-133964515 TTCATGCGTGGTTATATCTGTGG - Intergenic
939520051 2:143218621-143218643 TTCATTCAATGTTAGCTCTTGGG + Intronic
942591779 2:177553914-177553936 TTCATTCTTTGTTATATATTTGG + Intergenic
945610453 2:211994752-211994774 TCCCTTCAATGTGATATCTACGG - Intronic
945633555 2:212317314-212317336 TTTAATCGATGTAATATCTTGGG - Intronic
1169968984 20:11248241-11248263 TTCATTCCATTTGATTTCTAAGG + Intergenic
1177747671 21:25239996-25240018 GTCATTTGATGATATACCTAAGG - Intergenic
1177865008 21:26501702-26501724 TTCATTTTATGTTATCTCGATGG + Intronic
1180513857 22:16121136-16121158 TACCTTTGATGTCATATCTAAGG - Intergenic
951435776 3:22662402-22662424 TGCATTTGATGTTGTATCTCAGG - Intergenic
951916683 3:27808125-27808147 TTCATTTGCTGCTATATCTCAGG + Intergenic
957379526 3:79407985-79408007 TCAATTCTATGTTATGTCTATGG + Intronic
957848870 3:85779027-85779049 TTTAATTGATGTTAAATCTAGGG + Intronic
958559485 3:95726975-95726997 TATATTCAATGTTATATCTAAGG - Intergenic
962490358 3:135887626-135887648 TCCATTCCATGATATCTCTATGG + Intergenic
965411560 3:168338090-168338112 TTTATTAAATGTTATATTTAGGG + Intergenic
970924755 4:21438764-21438786 TTCATTTGAGGTTATAACTTAGG + Intronic
971379360 4:26082942-26082964 TTAATTCTATTTTATAGCTAGGG + Intergenic
973889133 4:55351844-55351866 TTCATTCAATGTTGTATCTATGG + Intronic
977193611 4:94030970-94030992 ATCATTGAATGTTATAACTAAGG + Intergenic
984648841 4:182247611-182247633 TTCTGTCCATGTTATATCTCTGG + Intronic
986907807 5:12517020-12517042 GTCATTTACTGTTATATCTAAGG - Intergenic
987513153 5:18868524-18868546 TACATTCGAGGCCATATCTAAGG + Intergenic
993175547 5:84480741-84480763 TTCATTCTATGTTGTTTCAAGGG - Intergenic
993230911 5:85234930-85234952 TTCATTCACTGTTATACCCAGGG - Intergenic
996543866 5:124657331-124657353 TTCTTTTCATGTTATATCTTGGG - Intronic
998298903 5:140999525-140999547 TTCATTGGCTGTCATATCCAGGG - Intronic
998984569 5:147741648-147741670 TTCATTCTAGGTTTTAACTAAGG + Intronic
1001011715 5:168104805-168104827 TCCATTCCATGTTATTTCCATGG - Intronic
1001562840 5:172680783-172680805 TTCATTTGATGTTATATCATAGG + Intronic
1003724036 6:8738788-8738810 TACTTTTGGTGTTATATCTAAGG - Intergenic
1009674447 6:66799394-66799416 TTCATTAAATGATATATCTTGGG + Intergenic
1012664754 6:101953796-101953818 TGCTTTTGATGTTATATCAAAGG + Intronic
1012754093 6:103202793-103202815 TTCATTGAAGGTTATATGTAAGG - Intergenic
1013904142 6:115195394-115195416 GTCACTCCATGTTATATCCAAGG - Intergenic
1014108433 6:117592970-117592992 TTTATTCAATGTTATAGCAAAGG - Intronic
1021146200 7:17092057-17092079 TTCATTTTATGTAATATCTGTGG + Intergenic
1021733784 7:23622772-23622794 ACCATTCAATGTTGTATCTATGG - Intronic
1022657943 7:32338067-32338089 TGCTTTCGATGTCATATCTAAGG - Intergenic
1024349676 7:48350969-48350991 TTCATTTTATGTTTTATCCAAGG - Intronic
1025317599 7:58051705-58051727 TTCATTCGATGATGTTTCCATGG - Intergenic
1025593128 7:62889057-62889079 TTCATTCTATTTTTTATCCAGGG - Intergenic
1028449026 7:90959293-90959315 TAAAATCTATGTTATATCTATGG + Intronic
1029607942 7:101610216-101610238 TGCTTTGGGTGTTATATCTAAGG - Intergenic
1032961061 7:137034999-137035021 TGCTTTCGATGTCAAATCTAAGG - Intergenic
1033182936 7:139198585-139198607 TTCATTCGATGTTATATCTATGG + Intergenic
1036099372 8:5760761-5760783 TTCATTTGATGTTTTATTTTTGG - Intergenic
1037045803 8:14301654-14301676 TTCATTCAAGGTAATATTTATGG + Intronic
1038069204 8:23994742-23994764 TGAATTTGATGTTATATCAAGGG + Intergenic
1040274771 8:46003944-46003966 TTCATTCTAGTTTTTATCTAGGG - Intergenic
1041579721 8:59445199-59445221 TTCACTGGATGTACTATCTAGGG + Intergenic
1043972762 8:86550554-86550576 TTCATGTGATGTTATATATTCGG + Intronic
1046736691 8:117783689-117783711 TTCACTGAATATTATATCTATGG - Intergenic
1050580579 9:7051132-7051154 TTCATATAATGTTATATTTATGG + Intronic
1055983916 9:82036312-82036334 GTCCTTCCATGTTATATCAAAGG + Intergenic
1057589246 9:96357676-96357698 TACTTTTGATGTTTTATCTAAGG - Intronic
1058538952 9:105992187-105992209 TTCATTAAGTGATATATCTAAGG - Intergenic
1062694947 9:137869160-137869182 TTAAATCTATGTTATATCTATGG - Intronic
1186551706 X:10512795-10512817 TGAACTTGATGTTATATCTAGGG + Intronic
1188119825 X:26290911-26290933 TTTTTTCCATATTATATCTATGG + Intergenic
1190028850 X:46952563-46952585 TTCCTTCGTTGTTATTTCTCTGG + Intronic
1192146713 X:68687550-68687572 TCAATTCCATGTTAAATCTATGG - Intronic
1193192940 X:78594424-78594446 TACATTCAATGTTATAAGTAAGG + Intergenic
1196038106 X:111169369-111169391 TCCATTCAATGTTGTATCTATGG - Intronic
1198894360 X:141435761-141435783 TTTATTCGATATTATACCTAGGG + Intergenic
1199249662 X:145646003-145646025 TTTATTTTATGTTATCTCTATGG - Intergenic