ID: 1033185542

View in Genome Browser
Species Human (GRCh38)
Location 7:139224890-139224912
Sequence CAACAGAGGGAGACCGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033185542_1033185548 27 Left 1033185542 7:139224890-139224912 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1033185548 7:139224940-139224962 CGCTGCAACCTCCCTGCCTCGGG 0: 39
1: 30
2: 34
3: 115
4: 1446
1033185542_1033185547 26 Left 1033185542 7:139224890-139224912 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1033185547 7:139224939-139224961 TCGCTGCAACCTCCCTGCCTCGG 0: 44
1: 25
2: 30
3: 193
4: 1920

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033185542 Original CRISPR CAACAGAGGGAGACCGAAGA AGG (reversed) Intergenic
No off target data available for this crispr