ID: 1033185547

View in Genome Browser
Species Human (GRCh38)
Location 7:139224939-139224961
Sequence TCGCTGCAACCTCCCTGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2212
Summary {0: 44, 1: 25, 2: 30, 3: 193, 4: 1920}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033185541_1033185547 27 Left 1033185541 7:139224889-139224911 CCCTTCTTCGGTCTCCCTCTGTT 0: 3
1: 6
2: 4
3: 59
4: 530
Right 1033185547 7:139224939-139224961 TCGCTGCAACCTCCCTGCCTCGG 0: 44
1: 25
2: 30
3: 193
4: 1920
1033185544_1033185547 13 Left 1033185544 7:139224903-139224925 CCCTCTGTTGCTGGACTGTACTG No data
Right 1033185547 7:139224939-139224961 TCGCTGCAACCTCCCTGCCTCGG 0: 44
1: 25
2: 30
3: 193
4: 1920
1033185546_1033185547 -10 Left 1033185546 7:139224926-139224948 CCGTGATCTCAGCTCGCTGCAAC 0: 23
1: 183
2: 570
3: 1113
4: 1634
Right 1033185547 7:139224939-139224961 TCGCTGCAACCTCCCTGCCTCGG 0: 44
1: 25
2: 30
3: 193
4: 1920
1033185542_1033185547 26 Left 1033185542 7:139224890-139224912 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1033185547 7:139224939-139224961 TCGCTGCAACCTCCCTGCCTCGG 0: 44
1: 25
2: 30
3: 193
4: 1920
1033185545_1033185547 12 Left 1033185545 7:139224904-139224926 CCTCTGTTGCTGGACTGTACTGC No data
Right 1033185547 7:139224939-139224961 TCGCTGCAACCTCCCTGCCTCGG 0: 44
1: 25
2: 30
3: 193
4: 1920

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033185547 Original CRISPR TCGCTGCAACCTCCCTGCCT CGG Intergenic
Too many off-targets to display for this crispr