ID: 1033186063

View in Genome Browser
Species Human (GRCh38)
Location 7:139227716-139227738
Sequence AGCAAATGTACTTGGCGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033186059_1033186063 17 Left 1033186059 7:139227676-139227698 CCACAGCTCGTCTCTTCATCTTG No data
Right 1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG 0: 1
1: 0
2: 2
3: 2
4: 49
1033186056_1033186063 25 Left 1033186056 7:139227668-139227690 CCAGATCCCCACAGCTCGTCTCT No data
Right 1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG 0: 1
1: 0
2: 2
3: 2
4: 49
1033186058_1033186063 18 Left 1033186058 7:139227675-139227697 CCCACAGCTCGTCTCTTCATCTT No data
Right 1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG 0: 1
1: 0
2: 2
3: 2
4: 49
1033186057_1033186063 19 Left 1033186057 7:139227674-139227696 CCCCACAGCTCGTCTCTTCATCT No data
Right 1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG 0: 1
1: 0
2: 2
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033186063 Original CRISPR AGCAAATGTACTTGGCGTAC TGG Intergenic
907815001 1:57910119-57910141 AGGAAATGAAATTGGGGTACAGG + Intronic
918966619 1:191358317-191358339 AGCAGAGGTACTTGGCGGTCTGG + Intergenic
920945538 1:210525012-210525034 AGGAAATGTACTTGGGATAGAGG + Intronic
1064708990 10:18103864-18103886 AGAAAATGAAATTGGCATACAGG + Intergenic
1068515869 10:58024637-58024659 AGCAAATATACTTATCCTACTGG + Intergenic
1069093037 10:64224654-64224676 AGAAAATGTACGTGACATACAGG + Intergenic
1077750303 11:4960135-4960157 AGCAAATGGACATGGCATAATGG + Intronic
1080013784 11:27483946-27483968 AGCAAATGTACTTGGTGTGCTGG - Intergenic
1087614626 11:100473642-100473664 AGCAAATGTATTTAGTGTAAGGG - Intergenic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1094529834 12:31263860-31263882 AGCAAAAGTTCTTAGTGTACGGG - Intergenic
1096949330 12:55449091-55449113 AGCAAATGTACTAGGAGTGTTGG + Intergenic
1099980286 12:89592708-89592730 AGCAATGGTACTTGCCTTACGGG + Intronic
1102781026 12:115564675-115564697 AGCAAATCTAGTTGTCGTAACGG + Intergenic
1105653750 13:22410081-22410103 AGGAAATGTAGTTTGCGTATGGG - Intergenic
1106305239 13:28503902-28503924 AGCAAATGTACACGGTGTGCTGG - Intergenic
1111990245 13:95109115-95109137 TGGAAAAGTACTTGGCATACAGG + Intronic
1113400520 13:109988433-109988455 GTCAAATTTACTTGGGGTACAGG + Intergenic
1122931875 14:104936850-104936872 AGCAAATCCACGTGGCGTAGCGG - Exonic
1124893928 15:33758324-33758346 AGCAAGTCTACTTGGCTTCCTGG - Intronic
1134145962 16:11762670-11762692 AGCAAATGTACCTGGAGCGCAGG - Exonic
1142786091 17:2224179-2224201 AGCAAATGTTCTTAGGGTAAAGG - Intronic
1146075000 17:29720042-29720064 AGCCACTGTACCTGGCCTACAGG + Intronic
1167739434 19:51315396-51315418 AGCAAATGTTCTTGGGGACCAGG + Intronic
930190633 2:48455572-48455594 AGCAAATGTAGTTGGTTTAGTGG + Intronic
938623965 2:133088365-133088387 AGCTATTGTACTTCACGTACGGG - Intronic
946003122 2:216499362-216499384 AGCAAGTGTACTTGGCGTGCTGG - Exonic
1173625107 20:44466725-44466747 AGCAAGTGTACTTGGCCTGCTGG + Intergenic
952236119 3:31481880-31481902 AGCAATTGTACTTGTTTTACAGG - Intergenic
952756655 3:36874774-36874796 AGCAAATGGAGTTGGCATCCAGG - Intronic
957107036 3:75903157-75903179 AGCAAATATACTTGGCTGAAGGG - Intergenic
960297321 3:115960081-115960103 AGCATATGAACTTGGGGTGCAGG - Intronic
966554701 3:181245789-181245811 AGCAAGTTTACCTGGCATACAGG - Intergenic
972082202 4:35167097-35167119 AGCAAATGGACTTAGAGTAATGG - Intergenic
974079032 4:57194295-57194317 AGCACATGGAATTGGAGTACAGG - Intergenic
984200156 4:176709612-176709634 AGGAAATGAGCTTGGCGTTCTGG + Intronic
984916056 4:184725822-184725844 AGCAAATGAACTTGGTGGAAAGG + Intronic
991575473 5:68098993-68099015 AGTACATGCACTTGGCCTACTGG + Intergenic
997309098 5:132865196-132865218 AGAATACGTACTTGGAGTACTGG + Exonic
1000894594 5:166840429-166840451 TGCATATGTACTGGGCATACTGG - Intergenic
1012879420 6:104767771-104767793 AGGAAATGTTCTGGGCTTACAGG - Intronic
1017661788 6:156681960-156681982 CGCAAATGTACTTAACGTCCCGG + Intergenic
1018394016 6:163363293-163363315 AGCAAGTATACTTGACGTGCTGG - Intergenic
1033112719 7:138596343-138596365 AGCAAATGAACTTGGTATATGGG - Intronic
1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG + Intergenic
1061064544 9:128269232-128269254 AGCCATTGCACTTGGCCTACTGG + Intronic
1062140900 9:134958380-134958402 AACAAATATACTTGGCGTTTAGG - Intergenic
1194915231 X:99698791-99698813 AGAAAATGTGCTGGGCGTGCAGG - Intergenic
1196305702 X:114100314-114100336 AGCAAATATAGTTGGAGTAGGGG + Intergenic
1199623150 X:149716580-149716602 AGGAAAAGTACCTGGTGTACCGG + Exonic
1199627969 X:149758060-149758082 AGGAAAAGTACCTGGTGTACCGG - Intergenic
1200018588 X:153183123-153183145 AGGAAAAGTACCTGGAGTACCGG + Exonic