ID: 1033188932

View in Genome Browser
Species Human (GRCh38)
Location 7:139258170-139258192
Sequence CTACTATTCTTAATGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033188932_1033188936 -2 Left 1033188932 7:139258170-139258192 CCATTTGTCATTAAGAATAGTAG 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1033188936 7:139258191-139258213 AGCAGTGGGAAGGAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033188932 Original CRISPR CTACTATTCTTAATGACAAA TGG (reversed) Intronic
905522502 1:38611274-38611296 CTTCTATTAATAATTACAAAGGG - Intergenic
908038185 1:60078822-60078844 CTACTAATCTTTATGACTAATGG + Intergenic
909279811 1:73735352-73735374 ATCCTATTCTTAATCAGAAAAGG - Intergenic
909954146 1:81756932-81756954 CTACTGTTATTCATGACATAAGG + Intronic
913501198 1:119474279-119474301 CTACTCTTCTAAATGAGAGATGG - Intergenic
917204139 1:172552078-172552100 TTACCATTCTAAATGATAAATGG + Intronic
917525436 1:175784331-175784353 ATACTATTCTCAAGGGCAAATGG - Intergenic
921469342 1:215529978-215530000 ATAAATTTCTTAATGACAAAGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922639588 1:227214943-227214965 CTGCAATTCTCAAAGACAAAAGG + Intronic
923928154 1:238659530-238659552 CTACTTTCTGTAATGACAAAGGG - Intergenic
1066082465 10:31945462-31945484 CTACTATTTGTAATAGCAAAAGG + Intergenic
1067293600 10:44961602-44961624 TTACTATTCTTATTGACACTGGG - Intronic
1068139383 10:52986184-52986206 GTACTTTTCTTAACAACAAAAGG - Intergenic
1068454410 10:57236578-57236600 ATACTATTCTTTATCACAAGAGG + Intergenic
1072112063 10:92332284-92332306 TTACTTTGCTTAATAACAAAAGG - Intronic
1072500545 10:96012617-96012639 CTACTGTTTTTAATGATGAAGGG + Exonic
1074602856 10:114932961-114932983 TTACTTTTCCTAATTACAAAAGG + Intergenic
1074656658 10:115596795-115596817 CTAATATTCTTAAAAATAAATGG - Intronic
1074789599 10:116873448-116873470 CTTCTATACTTAATGACTTAGGG + Intronic
1076185896 10:128448474-128448496 CTAATATTTTTAAAGAGAAATGG + Intergenic
1076222787 10:128747975-128747997 CTCCGATTCTCAATGACAACCGG + Intergenic
1077928006 11:6701343-6701365 CTACTCTTATAACTGACAAAGGG + Intergenic
1078381480 11:10845942-10845964 CTACATTTCTTTATGACAAAAGG + Intronic
1080343002 11:31290261-31290283 CCACTATTCTAAATGAAAAGAGG + Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1081367575 11:42254817-42254839 CTGCTATTCATAATAACCAAAGG - Intergenic
1084868502 11:72080115-72080137 CTGCTATTGTTAACGATAAAAGG + Intronic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1091460779 12:642528-642550 CTATTATTATTAATAACTAAGGG + Intronic
1092596187 12:10007161-10007183 CTAATTTTCTTAACAACAAATGG - Intronic
1093603029 12:21053583-21053605 ATATTATTCTTAGTGAAAAAAGG + Intronic
1096446994 12:51702356-51702378 CTATTATCCCAAATGACAAACGG - Intronic
1098173016 12:67765433-67765455 ATCCTATTCCTAATGAAAAATGG - Intergenic
1098848355 12:75565505-75565527 TTACGATTCTCTATGACAAATGG + Intergenic
1101922726 12:108945943-108945965 GAAATATTCTTAATCACAAATGG - Intronic
1102534721 12:113572721-113572743 CTTCCATTCTTAAGCACAAAAGG - Intergenic
1103398192 12:120624108-120624130 CATCTGTTCTTAATGAGAAATGG + Intergenic
1104677541 12:130723547-130723569 ATACAATTATAAATGACAAAGGG + Intergenic
1105654755 13:22424162-22424184 CTACTATTATTAAGTACATATGG - Intergenic
1105729287 13:23195962-23195984 ATACTATTTTAAATGAAAAAAGG + Intronic
1105939642 13:25135949-25135971 CTACAATTTTCAATGAGAAATGG - Intergenic
1106452550 13:29895861-29895883 CTAATATTCTTTATAATAAATGG + Intergenic
1108558328 13:51618848-51618870 CCACTATTCACAATGGCAAAAGG - Intronic
1108874389 13:55026405-55026427 GTATTTTTCTTAATGACAGAAGG - Intergenic
1109804642 13:67422438-67422460 ATACTATTATTAATCACAAAGGG - Intergenic
1111292903 13:86190421-86190443 CTACTAATCTTATTTATAAATGG + Intergenic
1111749951 13:92316763-92316785 ATAATATTCTAAATGAGAAAAGG + Intronic
1112468590 13:99667813-99667835 CTACTATTCCAATTGGCAAATGG + Intronic
1113055349 13:106261123-106261145 CAACTATTTTTACTGATAAAAGG - Intergenic
1113338117 13:109396149-109396171 CTACTATTGATAATGACAACAGG + Intergenic
1115050316 14:29053036-29053058 CTAATATTTCTAAGGACAAATGG + Intergenic
1115898708 14:38120151-38120173 CCACTATTCTAAATGATAGATGG - Intergenic
1115949894 14:38709342-38709364 AAACTACTCTTAGTGACAAAAGG + Intergenic
1116157441 14:41224530-41224552 CTAATTTATTTAATGACAAATGG + Intergenic
1118502673 14:66377805-66377827 CTACTATTTTTACTGCCAGAAGG - Intergenic
1120228877 14:81821308-81821330 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120228919 14:81821732-81821754 CTATTTTTCCTAATAACAAAGGG + Intergenic
1122677510 14:103428064-103428086 CTACAATTCTTAAGGATTAAGGG - Intronic
1124528635 15:30482559-30482581 ATATTATTCTTAATGTCGAAAGG - Intergenic
1124770021 15:32525138-32525160 ATATTATTCTTAATGTCGAAAGG + Intergenic
1127750842 15:62041127-62041149 CTTCTTTTTTTTATGACAAAAGG - Intronic
1127778137 15:62285046-62285068 ATTCTTTTCTTAATGACATAAGG + Intergenic
1128051671 15:64670284-64670306 ATACTATTCTCAGTGGCAAATGG + Intronic
1128992815 15:72274618-72274640 CTACTATGATGAATGAGAAAAGG + Intronic
1129325162 15:74796265-74796287 CTACTATTCTTTAAGTCGAAGGG + Intronic
1130194724 15:81768741-81768763 CAAATATTTTCAATGACAAATGG + Intergenic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1130602464 15:85285668-85285690 GTCTTATTCTTAGTGACAAAAGG + Intergenic
1130766423 15:86876048-86876070 CTCTTATTCTTAGTGACAAAAGG - Intronic
1131635142 15:94224885-94224907 ATACTCTTCTTAATAACAATAGG + Intergenic
1131736510 15:95338455-95338477 GTGCTATGCTTAGTGACAAAAGG - Intergenic
1133554271 16:6890007-6890029 CTACTATTATTAACCATAAATGG - Intronic
1134232691 16:12440968-12440990 CTACGATTCTAAGTCACAAAAGG - Intronic
1135761378 16:25140947-25140969 CCTCTATTCTTAAGGAGAAAGGG + Intronic
1135906470 16:26516682-26516704 ATACTTTACCTAATGACAAAGGG - Intergenic
1138782539 16:59806615-59806637 ATATTATACTTAAAGACAAATGG + Intergenic
1139340595 16:66265545-66265567 CTACTATTATTACTTCCAAATGG + Intergenic
1141722193 16:85762645-85762667 ATCCTTTTCTTTATGACAAATGG - Intergenic
1144016386 17:11200367-11200389 CAAGTATTCTAAATGAGAAAGGG + Intergenic
1147024982 17:37573668-37573690 ATACTACTCATAATGACAAAAGG - Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1149774675 17:59347966-59347988 CTATTATTTTTAATGGCCAATGG - Intronic
1150450819 17:65266210-65266232 CTACTTCTACTAATGACAAAAGG - Intergenic
1150982397 17:70157179-70157201 CTACTATGCTTCTTGACAACAGG - Intergenic
1152890296 17:82877318-82877340 CTGCTATTTTTAACAACAAATGG - Intronic
1153110024 18:1575045-1575067 TTACTATTATCAATGATAAAAGG - Intergenic
1153897017 18:9573174-9573196 CTAATGTTCTTTATAACAAAAGG - Intronic
1157218325 18:45804026-45804048 TTACTATACTAAATGACATAAGG + Intergenic
1157256539 18:46144557-46144579 GGACTATTCTTCATAACAAAGGG - Intergenic
1158332013 18:56373289-56373311 CCAAAAATCTTAATGACAAATGG + Intergenic
1159580052 18:70225075-70225097 GTGCTATTATTACTGACAAATGG + Intergenic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1161221876 19:3121657-3121679 CTTCTTTTCTTCATCACAAAAGG + Exonic
1165181677 19:33977025-33977047 ATACTATTCTTAATTCCTAAGGG - Intergenic
926463382 2:13161509-13161531 CTACTATTTATAACAACAAAAGG - Intergenic
926564839 2:14457412-14457434 TAACTATTCTTGATGAGAAATGG + Intergenic
927531601 2:23810060-23810082 CTACAATGCATAATGACACAGGG + Intronic
928753815 2:34500447-34500469 ACATTATTCTTAATGAAAAATGG + Intergenic
930667063 2:54109824-54109846 CTACCATTGTTAATGATAAATGG + Intronic
931100371 2:58992902-58992924 CAACTAATCTTACTGACAATAGG - Intergenic
931652449 2:64480704-64480726 CTACTATTCTTACAAACAAAAGG + Intergenic
931794291 2:65694515-65694537 CTATTATTCTTCATGACAAGTGG + Intergenic
933525453 2:83432266-83432288 CCAGTCTTATTAATGACAAAAGG + Intergenic
933552978 2:83797770-83797792 TAAATATTCTTAATGACTAATGG + Intergenic
935296246 2:101652035-101652057 TTTCCACTCTTAATGACAAATGG + Intergenic
936632555 2:114219412-114219434 CTAATATGCTTAAAGACTAAAGG + Intergenic
936952081 2:117987806-117987828 CTACCACTATTAATGACAGAAGG - Intronic
938809446 2:134839394-134839416 CAAAAGTTCTTAATGACAAAAGG - Intronic
939127996 2:138201268-138201290 CTACTATTCTCTATGAAAAATGG - Intergenic
939359414 2:141149349-141149371 GTAATATTCTTAATGTCAACTGG - Intronic
939627125 2:144491379-144491401 CTAATACTGTTAATGAAAAAAGG + Intronic
940727699 2:157353664-157353686 CGAATATTCTTAATGACACCTGG - Intergenic
941710636 2:168708918-168708940 GTATTATTTTTAATGAAAAATGG + Intronic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
943560985 2:189461790-189461812 ATAATATTCTTAATCACAAAGGG + Intronic
944155632 2:196604332-196604354 CTACTATTCATAGGCACAAAGGG - Intergenic
945636833 2:212365463-212365485 CCACTATTTTTAATGACACTTGG - Intronic
945910712 2:215646120-215646142 ATAGTATTCTAAATGACCAAAGG + Intergenic
946263238 2:218514634-218514656 CTATATTTCTTAATTACAAAAGG - Intronic
1169102824 20:2966534-2966556 CCACTATTCTTGATGAGATAGGG + Intronic
1169461191 20:5797141-5797163 CTACTCTTCTTGATGAAATAAGG + Intronic
1169637666 20:7710735-7710757 GTACTGTTCTTAGAGACAAAAGG + Intergenic
1171565034 20:26174747-26174769 CTAATATTCTCAAAGAAAAACGG + Intergenic
1178229088 21:30760250-30760272 ATGCTATTCCTAATGACATACGG - Intergenic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1184319795 22:43732184-43732206 CTACAATTATTAAAGGCAAATGG - Intronic
949332551 3:2938300-2938322 TTACTATTATTATTGACAGATGG - Intronic
949488102 3:4560451-4560473 CTACTATTTTTAAAGAAAGAAGG + Intronic
949496533 3:4637570-4637592 CTGCTATTCTCAGTGACACAAGG - Intronic
949528208 3:4927365-4927387 CTTTCATTTTTAATGACAAAAGG + Intergenic
956161253 3:66355466-66355488 CTACTTTTCATAATTAAAAATGG - Intronic
957045096 3:75367401-75367423 CTATTATTCTTAATCTCATAAGG + Intergenic
959909673 3:111749743-111749765 ATACTATTGTTAAAGAAAAAAGG - Intronic
960317661 3:116198190-116198212 CTACTGTTCATAGTGAGAAATGG + Intronic
962661922 3:137610519-137610541 CAACAATACTTAATGACAACAGG - Intergenic
965273232 3:166646475-166646497 GTTCTATCCTTAATTACAAAAGG + Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965498796 3:169432107-169432129 TCACTTTTCTTCATGACAAAGGG - Intronic
966267987 3:178069914-178069936 CAACTAAACTTAATGACATAGGG + Intergenic
968349155 3:198038142-198038164 GTACTATTAATAATGACAACAGG - Intronic
970146504 4:13041873-13041895 TTAATTTTCTTAAAGACAAAAGG + Intergenic
970712979 4:18885883-18885905 TTATTATTATTAATGACACAGGG - Intergenic
970746085 4:19297789-19297811 TTACTATTAATAATAACAAACGG + Intergenic
977104739 4:92867140-92867162 CAACCATTTTTAATGATAAATGG - Intronic
977633341 4:99268138-99268160 CTACAATTATTATTCACAAAAGG + Intergenic
979788305 4:124745353-124745375 CTATTTTTCTAAGTGACAAAAGG - Intergenic
980446606 4:132918643-132918665 TTACATTTCTTAAAGACAAATGG + Intergenic
981458584 4:144985576-144985598 TTACTAGTCATAATGACTAAAGG + Intronic
982931598 4:161415053-161415075 CCATTATTCTTAATGATAATAGG - Intronic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
984371325 4:178870008-178870030 CTAATATTCTGAGTGACAGAGGG + Intergenic
984962029 4:185107031-185107053 CTTTTATTCTTAATGCCAACAGG + Intergenic
988226470 5:28418444-28418466 CTACAAATATTAATAACAAATGG + Intergenic
992546941 5:77822574-77822596 TTCCTATTCTTAATGAGAACAGG + Intronic
994159822 5:96544993-96545015 TTAAGATTATTAATGACAAACGG + Intronic
994219054 5:97173939-97173961 CTAGCATTCTAAATGTCAAAGGG - Intronic
995000682 5:107124072-107124094 TGACTATTTTTAATCACAAAAGG + Intergenic
995015046 5:107300566-107300588 CTACTATTCTTTATATTAAATGG + Intergenic
995654531 5:114410320-114410342 CTACTATTCTTGCTCAGAAACGG - Intronic
996869381 5:128170467-128170489 TTATTACTCTTACTGACAAATGG - Intronic
997688165 5:135804096-135804118 ATAGTACTCTTAATGTCAAAGGG - Intergenic
998761083 5:145433197-145433219 TGATTATTTTTAATGACAAAAGG + Intergenic
1000076987 5:157799568-157799590 CTAAATTTCTTAATTACAAAGGG + Intronic
1002922696 6:1584313-1584335 CTTCCATACTTAATGACATATGG + Intergenic
1003167548 6:3694239-3694261 CAATTATTATTAATTACAAAGGG + Intergenic
1007879659 6:45150243-45150265 CTACTATTTTTAGTAAAAAAAGG - Intronic
1008033413 6:46721461-46721483 CAATTATTTTTAAAGACAAAGGG + Intronic
1008090365 6:47287656-47287678 CTACTCTTATAACTGACAAAGGG + Intronic
1008146686 6:47900060-47900082 ATATTATTCATAATGGCAAAAGG - Intronic
1008279549 6:49579541-49579563 ATAGTATTCTTAAGAACAAAAGG - Intergenic
1012602991 6:101120721-101120743 CAAATATTCTTAATGAGAAAAGG + Intergenic
1013068525 6:106706590-106706612 ATATTATTCTAAATGGCAAAAGG - Intergenic
1013298920 6:108784929-108784951 TTAAACTTCTTAATGACAAATGG - Intergenic
1014191786 6:118504588-118504610 CTAATATCCTTTATAACAAATGG + Intronic
1014208684 6:118685161-118685183 CTTATATTCTTAAAAACAAAAGG - Intronic
1015483223 6:133739325-133739347 CTACTATTATTATTGAAAATTGG + Intergenic
1015766387 6:136721710-136721732 CAATTATTTTTAATGAGAAATGG - Intronic
1017105436 6:150883603-150883625 ATACTTTTCTTAATGACACAAGG + Intronic
1017569508 6:155729423-155729445 AGACTAGTCTTAATGACAGAAGG + Intergenic
1023568238 7:41545659-41545681 TTATTATTCTTATTGACATATGG + Intergenic
1024865043 7:53895982-53896004 CTACTATTCGTCATCACAGATGG - Intergenic
1025068317 7:55876427-55876449 CTTCTCATCTTAATGGCAAACGG - Intergenic
1026596053 7:71735021-71735043 TTACTATTCTTAGTGACCAGGGG - Intergenic
1027682167 7:81234395-81234417 CAAATATTCTTAGTAACAAATGG + Intergenic
1031962192 7:128000107-128000129 CTAATATTTTTAATAACAAAGGG + Intronic
1032176260 7:129629669-129629691 CTACTATTCTGCGTAACAAATGG - Intronic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1033777838 7:144632722-144632744 ATACTATTGACAATGACAAAAGG + Intronic
1034738162 7:153448027-153448049 TTGCTATTTTTAATGAAAAACGG - Intergenic
1034914953 7:155030052-155030074 CTAATAATCTTATTGAAAAATGG - Intergenic
1040676373 8:49756042-49756064 CTGCTGTTGTTACTGACAAAGGG + Intergenic
1040889572 8:52302882-52302904 TTACTATTATGATTGACAAATGG - Intronic
1046289806 8:112142889-112142911 CTAATTTTCTTCATGACTAAAGG + Intergenic
1047101725 8:121683720-121683742 CTATTACACTTAATGAGAAAAGG - Intergenic
1047896776 8:129374929-129374951 TCACTTTTCTTAGTGACAAAAGG + Intergenic
1049911226 9:270330-270352 CCAGGATTCTGAATGACAAATGG - Intronic
1051427043 9:16942659-16942681 CTACTATTTTTAATATCAAGAGG + Intergenic
1052100203 9:24436724-24436746 GTACTATTGTTTATGACAATTGG + Intergenic
1053561850 9:39204447-39204469 CTACTATTCTTAATCACAGTTGG - Intronic
1053827659 9:42042466-42042488 CCACTATTCTTAATCACAGTTGG - Intronic
1054135268 9:61414505-61414527 CTACTATTCTTAATCACAGTTGG + Intergenic
1054602902 9:67144976-67144998 CCACTATTCTTAATCACAGTTGG + Intergenic
1055225883 9:73994561-73994583 CAACATTTCTTAATGATAAAAGG - Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055658003 9:78471546-78471568 CTCCCATTCTTGATGGCAAATGG + Intergenic
1057732142 9:97619464-97619486 TTACTATTCTTTATGTTAAATGG - Intronic
1058011664 9:99984458-99984480 CAAGTATTCTAAATCACAAATGG + Intronic
1058499371 9:105594734-105594756 TTACTATTATTAATGAGACAGGG - Intronic
1058500135 9:105605073-105605095 CTACAATGCTGAATGACACAAGG + Intronic
1061462492 9:130751447-130751469 CTACTATTTTTAATGGGAAGGGG + Intronic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186305744 X:8255650-8255672 CTACAATTCTAAATGAGAGAGGG + Intergenic
1186708062 X:12163631-12163653 GTGCTATCCTTAATGGCAAAAGG - Intronic
1187035484 X:15534413-15534435 CTAATATTCTTAATTATATAGGG + Intronic
1188469868 X:30526171-30526193 CTTCTATCCTTGATGACACAGGG + Intergenic
1189824485 X:44903217-44903239 AAACTATCCTTAATTACAAAGGG - Intronic
1193632226 X:83904171-83904193 CTAATATTCTAATTAACAAATGG + Intergenic
1195464334 X:105163449-105163471 CTACTATTCTTATTGATTATGGG - Intronic
1197099784 X:122638483-122638505 CTACTGTTGTAAATGAAAAATGG + Intergenic
1200008278 X:153102364-153102386 GTACTATTCATCATGACAATGGG - Intergenic
1200668812 Y:6061111-6061133 GTACTATGTTTAATAACAAAGGG + Intergenic
1202143549 Y:21754241-21754263 ATACTATTCATCAAGACAAAGGG - Intergenic