ID: 1033190296

View in Genome Browser
Species Human (GRCh38)
Location 7:139271956-139271978
Sequence CTGGTTAATTTCCATTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033190296 Original CRISPR CTGGTTAATTTCCATTGTGA TGG (reversed) Intronic
904527026 1:31141448-31141470 CTGGTTCAGTTCCTTGGTGAGGG + Intergenic
906586765 1:46985065-46985087 CTGCTTAGTTTACACTGTGAGGG - Intergenic
908583375 1:65541993-65542015 CTGTTTAATTTCTATTGTAAAGG - Intronic
909936696 1:81559332-81559354 CTGATTAGTGTCAATTGTGATGG + Intronic
910039126 1:82826528-82826550 CTGGTTATTTTCTATCGTTAAGG - Intergenic
910778139 1:90896812-90896834 GTGATTACTTTCCATTGTGCAGG - Intergenic
912161698 1:106993520-106993542 TAGGATATTTTCCATTGTGATGG + Intergenic
913072900 1:115317164-115317186 CTTGTAATTTTCCAATGTGATGG + Intronic
917696399 1:177528810-177528832 CTGTTTCGTTTCCATTTTGAAGG + Intergenic
918684414 1:187397172-187397194 CGGGTTTATTTACACTGTGAGGG - Intergenic
919301819 1:195779784-195779806 GTGGTGACTTTCCATTGTAAAGG + Intergenic
920217581 1:204372147-204372169 CTGTAAAATTTCCAGTGTGAGGG - Intronic
920507909 1:206529761-206529783 CTGGTTAATTTTTTTTTTGAAGG - Intronic
920607732 1:207406355-207406377 CTGGAGAATTTTCATTTTGAGGG - Intergenic
921422886 1:214969074-214969096 CAGCTTAATTCCCAGTGTGACGG + Intergenic
921815678 1:219560709-219560731 CTGGCTAATTTCTCTTGTTATGG - Intergenic
922334486 1:224607668-224607690 GTGGTTAATTTGCATTGTCAGGG + Intronic
924493988 1:244568625-244568647 CAGCTTTATTTCCACTGTGAGGG + Intronic
1065138322 10:22694893-22694915 CTGGTAAATTTCCATTTTTGTGG - Intronic
1068980948 10:63061745-63061767 GAGGTTAATTTCCACTGAGAAGG - Intergenic
1068983384 10:63084860-63084882 CTGGTTAAATTCCATTATCAAGG - Intergenic
1069119177 10:64547351-64547373 CTGGTTCATTTTGACTGTGAAGG + Intergenic
1070272496 10:74969810-74969832 CTCGCTAATTTCCAGTGTTAAGG + Intronic
1074506444 10:114075207-114075229 ATGGTTAATTACAATTGTGGTGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1080410813 11:32023280-32023302 TGGGTTAATTTGCACTGTGAAGG - Intronic
1081283770 11:41244078-41244100 ATGGATAATTTCCACTATGAAGG + Intronic
1084867831 11:72074188-72074210 CTGGTTAATTTTTTTTGAGATGG - Intronic
1086558431 11:88139636-88139658 CTGGTTAAGATGCATTGTGTTGG - Intronic
1086895789 11:92311215-92311237 CTGCATAAATTCCATAGTGATGG - Intergenic
1087749267 11:101989314-101989336 CTGGATAATTTTTATTGTGGGGG + Intronic
1088574618 11:111258346-111258368 ATGGGTAATATCCATTGTCAGGG + Intronic
1089238908 11:117057549-117057571 CTGGTTAATTTCCATGGCCTAGG - Intronic
1094288595 12:28820525-28820547 CTCCATGATTTCCATTGTGATGG - Intergenic
1094796827 12:33983884-33983906 CTGGTTAATTTGCATCTTGGTGG - Intergenic
1097491280 12:60273273-60273295 TTGTTTACTTTCCATTGTTAAGG - Intergenic
1099071354 12:78049001-78049023 CGGGTTTGTTTACATTGTGAGGG + Intronic
1099751643 12:86781799-86781821 CTGGATAATTTCCATAGTTGTGG + Intronic
1099893587 12:88618338-88618360 CTGTTTACTTTACATTCTGAAGG + Intergenic
1100111063 12:91242914-91242936 CCGGTTTGTTTACATTGTGAGGG - Intergenic
1103499288 12:121388455-121388477 CTGTTTAAATTCCTTTGGGATGG - Intronic
1104299068 12:127547555-127547577 GTGGATAATCTCCATTATGATGG - Intergenic
1105373713 13:19823601-19823623 ATGGTTAATTTCCATTTTATTGG - Intronic
1105423063 13:20270220-20270242 CTGTTTACTTTCCATAATGAAGG - Intergenic
1106372689 13:29151892-29151914 GTGGTTAATTACCTTTTTGATGG + Intronic
1107054822 13:36091531-36091553 TGGGTTATTTTCCATTTTGATGG - Intronic
1107277617 13:38693956-38693978 CTGGTTTATTTTCATGGAGAGGG + Intronic
1109879485 13:68452108-68452130 GTGATTATTTTCCAGTGTGATGG + Intergenic
1111355437 13:87094963-87094985 CAGATTAATTTCCAGTGTGCTGG - Intergenic
1111732387 13:92092980-92093002 CTGGATAATTTGCATTTTCATGG + Intronic
1111811626 13:93098859-93098881 TTGCTTAATGTCCACTGTGATGG + Intergenic
1116544247 14:46143243-46143265 CTGGTTAAGTACCATTTTAATGG - Intergenic
1117754838 14:58964056-58964078 CTGGTTAATTTGGTTTGTAATGG + Intergenic
1120759604 14:88273822-88273844 CTAGTTAATTTAAATTGTGGAGG - Intronic
1122084871 14:99292680-99292702 CTGGCTAATTTTCATAGAGATGG - Intergenic
1123433339 15:20236814-20236836 CTGGTTATTTTTCATAATGATGG - Intergenic
1123671096 15:22658462-22658484 CTGGATAATTTGCATTTTCATGG + Intergenic
1124323137 15:28731686-28731708 CTGGATAATTTGCATTTTCATGG + Intronic
1125517815 15:40332543-40332565 CTGCTTCAGTCCCATTGTGAGGG + Intronic
1128431082 15:67594482-67594504 CAGGTTATTTTCCATTGTCTGGG - Intronic
1128603023 15:69013832-69013854 CTGGTTAATTTCCAAAATCAGGG - Intronic
1128655059 15:69454475-69454497 CTGGCTATTTTCCATTGTACAGG + Intronic
1131804289 15:96105589-96105611 CTGTTGCATTTCCATTGTCAAGG - Intergenic
1132153993 15:99482625-99482647 GTATTTAATTGCCATTGTGATGG - Intergenic
1134632055 16:15763703-15763725 CTGGTTATTTTTCAAGGTGAAGG - Intronic
1136252293 16:29013550-29013572 ATGTTTAATTGCCATCGTGATGG + Intergenic
1136851285 16:33614307-33614329 CTGGTTATTTTTCATAATGATGG + Intergenic
1137556897 16:49476345-49476367 TTGGTTCATTCCCATTGTAAGGG - Intergenic
1140331284 16:74059448-74059470 CTGGTCATTTTCCACTTTGATGG + Intergenic
1140649845 16:77076008-77076030 GTGGTTAATTCCCAGTGAGAAGG - Intergenic
1203112887 16_KI270728v1_random:1462768-1462790 CTGGTTATTTTTCATAATGATGG + Intergenic
1142726750 17:1820920-1820942 TTGGTTACTTTAGATTGTGATGG + Intronic
1143751469 17:9031292-9031314 CTGCTTGATTGCCATTGTCAGGG + Intronic
1145834430 17:27943558-27943580 CCATTTAATTGCCATTGTGATGG + Intergenic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1149772858 17:59334477-59334499 CTGGTTACTTCCCATTGTGATGG + Intronic
1150186848 17:63191041-63191063 CTGGTAAATTTTCATTTTGCAGG + Intronic
1150889744 17:69134242-69134264 CAACTTAATTCCCATTGTGATGG + Intronic
1150899375 17:69254521-69254543 TTGCTTAATTTACACTGTGAAGG + Intronic
1153403156 18:4703838-4703860 ATGGTTTAATTCAATTGTGATGG + Intergenic
1154389018 18:13920648-13920670 TTGTTTAAGTTGCATTGTGAGGG + Intergenic
1156619071 18:38827243-38827265 CTGATTAATTTTCCTTGTCATGG + Intergenic
1158972329 18:62680018-62680040 GTGATTAAGTTCCATTGTGGAGG + Intergenic
1159905923 18:74092392-74092414 CTGGTTAAGAACCATTGTGGGGG + Intronic
1161907390 19:7167013-7167035 CTAGTTAATTTGCATTGTACTGG + Intronic
1165029542 19:32987877-32987899 CTGGTTATTTTTCATAATGATGG - Intronic
1166427717 19:42694288-42694310 CTGTTTAATTAGCATTGTGCTGG - Intronic
1167107306 19:47437790-47437812 CTGGTTCATTTCCTTGGGGAGGG - Intronic
1167404502 19:49295858-49295880 CTGCTTCATTTTTATTGTGAAGG - Intronic
1168541805 19:57218799-57218821 TTGTTTAATTTCCATTGGGTGGG + Exonic
926496201 2:13592084-13592106 CTGGTTAGATTCCATTGCGGGGG + Intergenic
929442841 2:41978870-41978892 CTGGTGAGTTTCCATTTTAAAGG - Intergenic
930495805 2:52141417-52141439 TTGGGGACTTTCCATTGTGAAGG + Intergenic
931223199 2:60306703-60306725 TTGTTTAATTTTCATTATGAAGG - Intergenic
934900649 2:98157308-98157330 ATGGTTAATTTCCATAGGGTGGG + Intronic
935089535 2:99881352-99881374 CTATTTAATTTACATTTTGAGGG - Intronic
936407695 2:112221880-112221902 CTGGTTAATAACCATTGCTAGGG + Intronic
940100831 2:150036266-150036288 CTGGTTAAGGTCCATTGCTAGGG - Intergenic
940411712 2:153372005-153372027 CTGCTTACTTTCTCTTGTGAGGG + Intergenic
941049619 2:160718052-160718074 CTGTTTAATTTCCAGTGATATGG + Intergenic
942883889 2:180898567-180898589 TTGGAAAATTACCATTGTGATGG - Intergenic
946687758 2:222288907-222288929 GTGGTCATCTTCCATTGTGAGGG - Intronic
947891866 2:233630464-233630486 CTGGTTGATTTTCTTTGTGCAGG + Intronic
1169352777 20:4882883-4882905 CTGGTTAAATTCCAGAGTAATGG + Intronic
1173327933 20:42050614-42050636 CTGGTGAATATTCCTTGTGAAGG + Intergenic
1174653528 20:52150414-52150436 CTGGGAAACTTCCATTGTCATGG - Intronic
1178228314 21:30751060-30751082 CAACTTAATTGCCATTGTGAAGG + Intergenic
1181686028 22:24528933-24528955 CTAGTTTTGTTCCATTGTGATGG - Intergenic
1181908978 22:26222820-26222842 CTGGTTAAGAACCACTGTGATGG - Intronic
1182952477 22:34390593-34390615 CTGCTTTGTTTACATTGTGAGGG + Intergenic
1184306780 22:43608442-43608464 CTGGTTGGTTTCCATTCTTATGG - Intronic
949840063 3:8310911-8310933 GTGGTTGATTTCCATGGAGATGG - Intergenic
953770205 3:45773930-45773952 CTGCTTAGTGCCCATTGTGATGG - Intronic
956095650 3:65713265-65713287 CGGGCTAGTTTCCATGGTGATGG - Intronic
956260662 3:67336746-67336768 CTGGCTAGGATCCATTGTGAAGG - Intergenic
957666487 3:83236722-83236744 ATGGTTAATTTTCATTATGTTGG - Intergenic
959072766 3:101718231-101718253 GTGGTTTCTTTCCATTGTCATGG + Intergenic
963341061 3:144034384-144034406 CCTGTTCATTTCAATTGTGAAGG + Intronic
963781362 3:149489771-149489793 CTGGTTAGTTGCTGTTGTGAGGG - Intronic
965832298 3:172806191-172806213 CTGGTTATTTTGTATTCTGAAGG - Intronic
966241959 3:177764361-177764383 CTCATTAATTTCCATTTAGATGG + Intergenic
973682708 4:53337449-53337471 TTTGATAATTTCCATTGTTATGG - Intronic
974494565 4:62609772-62609794 TTGATTTATTTCCATTGGGATGG + Intergenic
974496068 4:62629512-62629534 TAGATTAATTTCCAGTGTGAGGG + Intergenic
975110217 4:70615273-70615295 ATGGATAATTTCCATAGTCATGG + Intergenic
976671121 4:87654890-87654912 GCTGTTAATTTACATTGTGAGGG + Intronic
977411431 4:96671116-96671138 CTAGCTACTTTCAATTGTGAAGG - Intergenic
978070768 4:104465284-104465306 TTGGTTGAATTCCATGGTGATGG + Intergenic
984521480 4:180807080-180807102 CTAGCTGATTTTCATTGTGAAGG + Intergenic
984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG + Intergenic
986034438 5:3924589-3924611 CTGGTTCATCTCCATGGAGAGGG - Intergenic
987046862 5:14116713-14116735 CTGCTCATCTTCCATTGTGATGG - Intergenic
988662683 5:33290451-33290473 CTGGTTAATTTCCATGACAATGG + Intergenic
990146098 5:52761995-52762017 AATCTTAATTTCCATTGTGATGG + Intergenic
992687420 5:79212050-79212072 CTGGTTAATTTTTATAGAGATGG - Intronic
993787083 5:92155258-92155280 CTGCTTAATTTCCAAACTGAGGG + Intergenic
996746562 5:126851269-126851291 CTGGTTAATTTGGAGTTTGAGGG + Intergenic
1000399325 5:160809119-160809141 CGGGTTAATTTTTACTGTGAAGG + Intronic
1000999602 5:167993395-167993417 ATGCTTAATTTCCCTTCTGATGG - Intronic
1003821398 6:9901509-9901531 CTGTTTCTTTTCCATTCTGATGG - Intronic
1004532966 6:16471285-16471307 GTGATTAACTTACATTGTGATGG - Intronic
1006898845 6:37487048-37487070 CTGGTTAATTTCCCAGGAGAAGG - Intronic
1007201153 6:40110331-40110353 CAGTTTAATTTCCAGTTTGAGGG + Intergenic
1008246930 6:49187589-49187611 CTGGATAAATTCCATTCTCACGG + Intergenic
1008247623 6:49197643-49197665 CTAATTAATTTACATTGTTAGGG - Intergenic
1010116555 6:72318331-72318353 CTGCATAATTTCCAGTGTAATGG - Intronic
1011751146 6:90456142-90456164 ATGGATACTTTACATTGTGAGGG + Intergenic
1013169874 6:107627092-107627114 CTGGATGATTTGTATTGTGAAGG + Intronic
1014953542 6:127588174-127588196 CTGGTTGTTTTCCATAATGATGG + Intronic
1016468616 6:144351337-144351359 CTGGTAAATTTTCAATATGATGG - Intronic
1017378754 6:153802284-153802306 CTGGTTCATTTCCTCTGTGAGGG - Intergenic
1017997496 6:159545133-159545155 ATGGTTATTTTCCTCTGTGAAGG + Intergenic
1020772002 7:12406368-12406390 CAGGTTAATTTACAAAGTGATGG + Intergenic
1021023052 7:15628264-15628286 CTAGTGAATTTCCATTATGCAGG - Intronic
1021502312 7:21345088-21345110 CTGCTTTATTTACACTGTGAGGG + Intergenic
1022597920 7:31730458-31730480 CTGGTTAGTTTCCAGTGGGGAGG - Intergenic
1023271089 7:38463250-38463272 CTGGTTAATTGCAACAGTGATGG + Intronic
1023498623 7:40824888-40824910 ATATTTAATTGCCATTGTGATGG - Intronic
1024604968 7:51015556-51015578 CTAGTTCATTTTCCTTGTGAGGG - Intergenic
1025946882 7:66111426-66111448 CTGGTTAATTTCTATTTTTTTGG + Intronic
1026427663 7:70312586-70312608 CTGATTTATTTTAATTGTGAGGG - Intronic
1028436965 7:90815225-90815247 CTGGTTTAGTTCCATTTTGATGG - Intronic
1029299055 7:99564138-99564160 CTGTTTAATTTCAAATGTTAGGG + Intronic
1030445056 7:109638698-109638720 TTGAATTATTTCCATTGTGATGG - Intergenic
1030497616 7:110319413-110319435 CTGGTTAATGTCCAGACTGAGGG + Intergenic
1033190296 7:139271956-139271978 CTGGTTAATTTCCATTGTGATGG - Intronic
1037204796 8:16303661-16303683 TTGGATAGTTTCCATTGTTATGG + Intronic
1038909717 8:31949428-31949450 CTGTTTAATTTTCATTTTGATGG - Intronic
1039517765 8:38147711-38147733 CTGGTTACTGTCCCCTGTGATGG + Intronic
1043276010 8:78393763-78393785 CTGGTCAATTTCTATTGCAAGGG + Intergenic
1043499881 8:80842402-80842424 CTGATTAATATCCAATGTGATGG + Intronic
1043815601 8:84797299-84797321 AAGTTTAATTGCCATTGTGATGG - Intronic
1044799783 8:95942326-95942348 TTGGTTGATTTCCAGTCTGAAGG - Intergenic
1045630025 8:104107973-104107995 GTAGTTTATTTCCATTGTGGGGG - Intronic
1047576307 8:126159366-126159388 CTGATTAAGTTCTATTCTGATGG + Intergenic
1047783245 8:128127382-128127404 CTAGTTAATATCCATTTTGGAGG - Intergenic
1047889305 8:129290392-129290414 CTTGTTCATAGCCATTGTGAAGG + Intergenic
1055240580 9:74181094-74181116 GTGGTTAATTTGCATGGAGACGG + Intergenic
1055673950 9:78635846-78635868 GTGGTTAAATTTCATTGTGTTGG + Intergenic
1056320361 9:85429659-85429681 CTGGTTAATTTCATCTGTGCTGG - Intergenic
1060695008 9:125701903-125701925 ATGGTAAATTGCCAGTGTGAGGG - Intronic
1061272773 9:129552958-129552980 GGGATTAATTTCCTTTGTGAGGG + Intergenic
1061316422 9:129799015-129799037 ATGGTTAGTCTCCATTGTGGTGG - Intergenic
1062676420 9:137748039-137748061 TTAGTTAATTTTCATTGTTATGG + Intronic
1185712834 X:2317895-2317917 GTTGTTAATTTACATTGTCAGGG + Intronic
1188537492 X:31213739-31213761 CTGTTTAACTTCCACTGTCAGGG + Intronic
1188632453 X:32382235-32382257 CAGATTAATTTCAATTGTAATGG + Intronic
1189176952 X:38967098-38967120 CTGGTTAACTTGGATTGTCATGG - Intergenic
1190232106 X:48590233-48590255 CTGGTTCATGTCCCTTGTGCCGG - Intronic
1192011163 X:67274884-67274906 CTTTTTTATTTCCATTGTCATGG + Intergenic
1194024032 X:88728658-88728680 TTGGTTAGTTTCCATTGAAATGG - Intergenic
1195152357 X:102084892-102084914 CTGGGGCATTTCCACTGTGAAGG - Intergenic
1195155299 X:102116548-102116570 CTGGTTAATAACCATTGCTAGGG - Intergenic
1195951260 X:110276101-110276123 TTGGATAATTTCTATTGTTATGG + Intronic
1201077477 Y:10198603-10198625 CTGGTTAATTCCGATAATGAAGG + Intergenic