ID: 1033190938

View in Genome Browser
Species Human (GRCh38)
Location 7:139278473-139278495
Sequence AAAAAAAGGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3332
Summary {0: 1, 1: 3, 2: 22, 3: 353, 4: 2953}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033190938 Original CRISPR AAAAAAAGGGAGAAGGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr