ID: 1033199940

View in Genome Browser
Species Human (GRCh38)
Location 7:139359956-139359978
Sequence CTGGCGGGTGGCGGTGTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033199940 Original CRISPR CTGGCGGGTGGCGGTGTTGA AGG Exonic
900285268 1:1896022-1896044 CTGGGGGGTGGAGGAGGTGATGG + Intergenic
900420175 1:2552829-2552851 CTGGAAGGTGGGGATGTTGAAGG + Intergenic
900424256 1:2568829-2568851 CTGGAAGGTGGGGATGTTGAAGG - Intergenic
900496333 1:2977701-2977723 ATGGCGGGTGCTGGTGTGGATGG + Intergenic
900975147 1:6012045-6012067 GTGGTGGGTGGAGGTGATGAAGG + Intronic
901425937 1:9182496-9182518 CAGGCGGGCGGCGGCGGTGAAGG - Intergenic
902308949 1:15565759-15565781 TTGGCGGGTGGAGGTGGTGGAGG - Intronic
902568445 1:17331163-17331185 CTGTGGGGTGGCAGTGTGGATGG + Intronic
902835661 1:19045207-19045229 CTGAGGGGTGGCGGTGATGGTGG - Intergenic
902856478 1:19210034-19210056 CTGGCGGGCGACGCTGTTGTGGG - Intronic
903468497 1:23568536-23568558 CTGGCGGGAGGCGGCGTGCAGGG - Intergenic
905126055 1:35716995-35717017 TTGGCGGGGGGCGGTGGTGGAGG - Intronic
906390214 1:45408699-45408721 CTGGCAAGTGGCAGGGTTGAGGG + Intronic
906535007 1:46546557-46546579 CTGGAGGGTGCAGGTGTGGAGGG + Intronic
910119288 1:83767787-83767809 CTAGAGGGTAGGGGTGTTGAGGG - Intergenic
911042068 1:93599015-93599037 CTGGGGAGTGGCGGGGTTGCTGG - Intronic
911446653 1:98002315-98002337 ATGGTGGATGGTGGTGTTGATGG - Intergenic
912432575 1:109636803-109636825 CTGGCTGGTGGCAGTGTGGGTGG + Intergenic
916963968 1:169916228-169916250 GTGGCGGGGGGGGGTGGTGAGGG + Intergenic
921284059 1:213593319-213593341 CTGGCTGCTTGCTGTGTTGAGGG + Intergenic
922208451 1:223469012-223469034 TTGGCTGGTGGCCATGTTGAAGG - Intergenic
924582374 1:245333512-245333534 CTGGAGGTGGGCGGTGGTGACGG + Intronic
1063028857 10:2211318-2211340 GTGGTGGGTGGCAGTGGTGATGG - Intergenic
1063375626 10:5552692-5552714 CTGGCGGGTGGTGGAGATGCAGG - Intergenic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1074111416 10:110425324-110425346 CTGGAGGATGGAGGTGTAGATGG - Intergenic
1075797673 10:125132501-125132523 CTGGCGAGGGGCGGAGTTGGAGG + Intronic
1076410820 10:130248571-130248593 GTGGCGGTTGGCGGGGTTGGAGG - Intergenic
1077240607 11:1508550-1508572 ATGGCGGGTGGCTTTGCTGAGGG - Intergenic
1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG + Intergenic
1083896431 11:65622162-65622184 GTGGGGGGTGGCGGGGCTGACGG + Intronic
1083989666 11:66239180-66239202 CTGGAGGGTGGTGATGTGGAGGG - Exonic
1084953623 11:72679951-72679973 TTGGAGGGTGGTGGTGGTGAGGG - Intergenic
1088796199 11:113268667-113268689 CGGGAGGGTGGTGGTATTGATGG - Intronic
1090196031 11:124817424-124817446 CTGGCTGGTGGCTGTCTTCATGG - Intergenic
1092726513 12:11491526-11491548 CTGGGGGGTGTCGGTGGGGAGGG + Intronic
1093914269 12:24783430-24783452 TTGGGGGGTGGGGGTGGTGAGGG + Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096485007 12:51974156-51974178 TTGGCGGGTGGAGGTGGTGGGGG - Intronic
1102219777 12:111186627-111186649 CTGGCAGATGGCGGCGCTGAAGG - Intronic
1103324577 12:120111911-120111933 CTCGGGGGTGGCTGTGGTGAAGG - Intronic
1112766570 13:102752056-102752078 CTGGCTGGTTGCTTTGTTGAAGG - Intronic
1117912685 14:60649634-60649656 CTGGGGGTTGGGGGTGTTGCCGG + Intronic
1119204556 14:72784379-72784401 CTGGCATGTAGAGGTGTTGAGGG - Intronic
1119663619 14:76468396-76468418 TTGGGGGGTGGTGGTGTTGGGGG - Intronic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG + Intergenic
1202859255 14_GL000225v1_random:71597-71619 GTGGGGGGTGGGGGTGGTGAGGG + Intergenic
1124955885 15:34360085-34360107 ATGGGGGGTGGCGGTGGTGGGGG - Intronic
1125468236 15:39976460-39976482 CTGCCGGCTGGCCGGGTTGATGG - Exonic
1125645268 15:41267173-41267195 CTGGGGGATGGTGGTGGTGATGG + Intronic
1128538062 15:68505344-68505366 GTGGAGGGTGGGGGTGTTTAGGG + Intergenic
1128977931 15:72166997-72167019 CTGGCTGGTGTTGGTGGTGATGG + Exonic
1132313508 15:100874452-100874474 CTTGCCGGTGGTGGTATTGAGGG + Intergenic
1132883172 16:2171201-2171223 CTGGGTGGTGGCGGGGCTGAGGG + Intronic
1132897348 16:2235346-2235368 CTCGGGGGTGGCGATGGTGATGG - Exonic
1133342250 16:5044358-5044380 CTTGGTGGTGGCGGTGTGGATGG + Exonic
1133732789 16:8590554-8590576 CTGGAGGCTGCCGGTGTGGAAGG + Intergenic
1136641560 16:31569453-31569475 CTGGAGGGTGGTGGTGATGATGG + Intergenic
1141631197 16:85289009-85289031 CTGGCAGGTGGAGGTGAGGAAGG - Intergenic
1141950362 16:87335624-87335646 CTGGTGGGTGGTGGGGGTGAGGG - Intronic
1142005827 16:87689204-87689226 CAGGCGGGTAGGGGTGTTGGCGG + Intronic
1142009833 16:87708312-87708334 CTGGCGGGTGGCGCGGCTGCTGG - Intronic
1143585553 17:7848662-7848684 CTGGGGGGTGGGGGTGGTGGTGG - Exonic
1144626258 17:16845795-16845817 CTGGCGGATGGAGGTGGTCATGG + Intergenic
1144880175 17:18426925-18426947 CTGGCGGATGGAGGTGGTCATGG - Intergenic
1145152059 17:20517459-20517481 CTGGCGGATGGAGGTGGTCATGG + Intergenic
1145835183 17:27949438-27949460 CTGGCAGGTCGTGGTGGTGAGGG - Intergenic
1145948072 17:28793044-28793066 CTGTTGGGTGGGGGTGTTGGGGG - Intronic
1147580404 17:41624489-41624511 CTGGCGGATGGAGGTGGTCATGG + Exonic
1149469667 17:56905831-56905853 CTGGAGAGTGGGGGTGGTGAAGG + Intronic
1150682337 17:67293882-67293904 CTAGGGGGTGGCGCTGTTCACGG - Intergenic
1150953099 17:69824217-69824239 CTAGGGGGTAGGGGTGTTGAAGG - Intergenic
1151013722 17:70531015-70531037 CTGGAGGGTGGGGGGGTGGAGGG + Intergenic
1152572371 17:81126512-81126534 CTGCCGGGTGGCGGAGTCCATGG - Exonic
1154126477 18:11696947-11696969 CTGGAGGATGGCGGTGCTAAGGG - Intronic
1156249317 18:35336398-35336420 GTAGCGGATGGCAGTGTTGAAGG - Exonic
1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG + Intergenic
1157580853 18:48773465-48773487 CTGGCTGGTGGGGGTGGTGGTGG - Intronic
1159497476 18:69224639-69224661 TTGGAGTGTGGCGATGTTGAGGG - Intergenic
1161590387 19:5126768-5126790 CGGGAGGGTGGCAGTGTTGAAGG + Intronic
1163591448 19:18196366-18196388 CAGGTGGATGGCAGTGTTGAGGG - Exonic
1163719404 19:18891576-18891598 CTGGGGGTTGGGGGTGTGGAGGG - Intronic
1164815174 19:31193400-31193422 CTGGATGGTGGCTGTCTTGATGG + Intergenic
1165166971 19:33863633-33863655 CAAGCGGGTGGGGGTGTTGGTGG + Intergenic
1165447732 19:35865893-35865915 CTGAGGGGTGTCGGTGTGGAAGG - Intronic
1165861222 19:38910607-38910629 CTGGCTGGTGGTGGTGGTGGTGG + Exonic
1166256209 19:41606646-41606668 CTGGAGGGTGGTGGTGTCCAGGG - Intronic
1167499588 19:49837610-49837632 CTGGGTGGTGGCGGTGTCGGGGG + Intronic
1168147955 19:54430133-54430155 CTGGCGGGTGGCGGGGCTCCAGG - Intronic
1168293889 19:55369688-55369710 CTGGCGGGTGGCCGGGTGGGCGG - Intronic
927777349 2:25912452-25912474 ATGGAGGATGGTGGTGTTGAGGG + Intergenic
927846547 2:26475252-26475274 CAGGTGGGTGGCGGAGGTGAGGG + Intronic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
932757416 2:74418023-74418045 GTGGCTGGAGGCGGTGGTGATGG + Intronic
934575407 2:95397465-95397487 ATGGCAGGTGCCGGTGTGGAGGG + Intergenic
936608623 2:113980200-113980222 CTGGCAGGCGGTGGTGATGACGG - Intergenic
937113374 2:119384861-119384883 CTGGTGGGTGGCAGGGTGGAGGG - Intergenic
942527898 2:176875137-176875159 GTGGTGGGTGGTGGTGTTGTGGG + Intergenic
946185931 2:217980326-217980348 CGGGCTGGTGGTGGTGCTGAGGG - Intronic
948059266 2:235031554-235031576 CTGGCGGAACGCGGTGGTGAAGG - Intronic
1170769495 20:19319693-19319715 CATGGGGGAGGCGGTGTTGAGGG + Intronic
1171396343 20:24836238-24836260 CTGGAGGGTGGGTGTGTGGAGGG - Intergenic
1172093805 20:32450983-32451005 CTGGGGGGTGGCGGGGGTCAAGG + Intronic
1175177422 20:57120572-57120594 CAGGCTGCTGGGGGTGTTGATGG + Intergenic
1175251065 20:57610508-57610530 GTGGCGGGTGGAGGTGTGGCGGG - Intronic
1175604712 20:60303310-60303332 GTGACGGGTGGATGTGTTGATGG - Intergenic
1178104440 21:29301895-29301917 GGGGCGGGTGGCGGCGGTGAGGG + Intronic
1178561211 21:33641710-33641732 CTGGAAGGTGGCGGTGGTGAAGG - Exonic
1181114203 22:20621087-20621109 CTGGAGGGTGGGGGTGAGGAGGG - Intergenic
1181674179 22:24441258-24441280 CTGGCGGGTGGCCGTTGAGACGG - Exonic
1181889077 22:26045760-26045782 TTTGCGGGTGGCAGTCTTGAAGG - Intergenic
1182134662 22:27890210-27890232 GTGGGGGTGGGCGGTGTTGAAGG - Intronic
1182782660 22:32880529-32880551 CTGGTGGGTGGTGGTGGAGAGGG + Intronic
1182897655 22:33872508-33872530 TGGGGGGGTGGCGGTGTTGGTGG - Intronic
1184538856 22:45106553-45106575 CTGACGGGTGCTGGGGTTGATGG - Intergenic
1185228461 22:49667400-49667422 GGGGAGGGTGGGGGTGTTGAGGG - Intergenic
950524639 3:13516714-13516736 GAGGCGGGGGGCGGTGTTGGAGG + Intergenic
951706651 3:25550736-25550758 CTGTCAGGTGGCGGTGGGGAGGG - Intronic
952979739 3:38725084-38725106 CTGGAGGGTGGCGGTGAAGGTGG - Intronic
954083209 3:48224468-48224490 CTGGGGGCTGGGGGTGTTGGTGG + Intronic
955396223 3:58559672-58559694 CTGGCTGGTGTTTGTGTTGAGGG + Intergenic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
959043031 3:101441035-101441057 ATGGCGGGTGTGGGTGCTGATGG - Intronic
960973149 3:123153646-123153668 ATGGGGGGTGGGGGTGTAGAGGG - Intronic
961780452 3:129317417-129317439 CTGGGGGGTGGCAGGGTTGCAGG + Intergenic
962310152 3:134320542-134320564 CTGGGGGGTGGGGGTGCTGCAGG - Intergenic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
967158926 3:186718143-186718165 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967159018 3:186718392-186718414 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967754135 3:193149526-193149548 CTGCGGGGAGGCAGTGTTGATGG - Intergenic
968518356 4:1024154-1024176 CTGGCGGGCGGGGGTGCTGGTGG + Intronic
968991549 4:3916769-3916791 GTGGGGGGTGGGGGGGTTGAGGG - Intergenic
969401111 4:6956267-6956289 CTGGAGTGTGGCGGAGTGGAGGG + Intronic
972649496 4:41003039-41003061 CTGGAGGGTGGCATAGTTGAGGG - Intronic
976002487 4:80388142-80388164 CTGTGGGGTGGAGGTGGTGAGGG + Intronic
976801898 4:89002298-89002320 CTGGATGCAGGCGGTGTTGAAGG - Intronic
980134416 4:128846177-128846199 ATGGGGGGTGGCAGTGCTGAGGG - Intronic
981190559 4:141857360-141857382 GGGGCTGGTGGGGGTGTTGAAGG + Intergenic
981644282 4:146980813-146980835 ATGGCTGGTGGCGGGGTGGAGGG + Intergenic
984625350 4:182001080-182001102 TTGGTGGGTGGTGGTGGTGAAGG - Intergenic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
985502634 5:258560-258582 CTGGCGGGGGGCGGAGCTCACGG - Intergenic
988098335 5:26646043-26646065 CTGGTGGGTGGTGATGGTGATGG + Intergenic
992426383 5:76662239-76662261 CGGGCCGGTGGCTGTGCTGATGG - Intronic
993030040 5:82695130-82695152 CTGGCAGGTGGAGCTGTAGAGGG - Intergenic
996871288 5:128195971-128195993 CTGGGGTGTGGAGGGGTTGAGGG + Intergenic
998371489 5:141664864-141664886 GTGGGGGGTGGGGGTGATGAGGG - Intronic
999731354 5:154478445-154478467 CGGGCTGCTGGGGGTGTTGAGGG + Intergenic
1000349036 5:160338393-160338415 TTGGGGGGTGGGGGAGTTGAGGG - Intronic
1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG + Exonic
1005876465 6:30013714-30013736 CTGGCAGGTGCCGATGTTGATGG - Intergenic
1006715922 6:36120513-36120535 GTGGGGGGTGGCGGTGGTGGTGG - Intergenic
1007409408 6:41653296-41653318 CTGCGGGGTGGCGGTGGAGAGGG - Intronic
1011427589 6:87247243-87247265 GTGGCAGGGGGCGGTGGTGAGGG - Intronic
1014116843 6:117675868-117675890 CGCGCGGGTGCCGGTGGTGACGG - Exonic
1014122358 6:117740058-117740080 CTGGCTGGTGGCGGCGGTGGGGG - Intergenic
1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG + Intergenic
1019450876 7:1097212-1097234 CTGGAGGGTGGCAGTGTTCGGGG - Intronic
1019626235 7:2017262-2017284 CAGGCGGCTGGCAGTGCTGACGG + Intronic
1020428437 7:8095253-8095275 CTGGGGGGTGGGGGGGTTGGGGG + Intergenic
1021261410 7:18462192-18462214 CTGGCGGGTGACTGTGAAGATGG - Intronic
1021489083 7:21198674-21198696 GTGGGGGGGGGCGGTGGTGAGGG + Intergenic
1022589248 7:31645591-31645613 GTGGTGGGTGGTGGTGATGATGG - Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1024301933 7:47893475-47893497 CAGGCGGGAAGCGGTGTGGATGG + Intronic
1025604626 7:63030424-63030446 CGGGCGGGGGGCGGTGTGGTCGG + Intergenic
1025936859 7:66044509-66044531 CTCGGGGGTGGGGGTGTTGGGGG + Intergenic
1026038139 7:66844557-66844579 CTGGCTGGAGGAGGTGTTGGGGG + Intergenic
1033033350 7:137847254-137847276 CTGGAGGGCGGCGGTGGAGAGGG - Intergenic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1035987854 8:4454219-4454241 AAGGAGGGTGGCGGTGTTGGGGG - Intronic
1036751334 8:11445315-11445337 GTGGTGGGTGGAGGTGGTGAGGG - Intronic
1039886513 8:41657090-41657112 TTGTGGGGTGGAGGTGTTGAGGG - Intronic
1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG + Intergenic
1048168914 8:132086610-132086632 CTGGCGTGTGTGTGTGTTGAGGG + Intronic
1048981340 8:139704478-139704500 CTGGCGGGTGGAGAGTTTGAGGG + Intergenic
1049181593 8:141225839-141225861 CTGGCGGGTGGAGGTGCCCAGGG - Intronic
1052612903 9:30799522-30799544 CTGGCGGGTGGCGTTTTGTATGG + Intergenic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1053410634 9:37914263-37914285 GTGGTGGGTGGCGGTGGTGGCGG - Intronic
1056951287 9:91042666-91042688 GTGGTGGGAGGGGGTGTTGAAGG + Intergenic
1056951323 9:91042914-91042936 GTGGTGGGAGGGGGTGTTGAAGG - Intergenic
1057038928 9:91833513-91833535 CTGGCGTGTGGCGGTGCTGGTGG - Intronic
1057354248 9:94321517-94321539 CTGGCCGGGGGTGGGGTTGATGG + Intronic
1057653516 9:96936118-96936140 CTGGCCGGGGGTGGGGTTGATGG - Intronic
1058894564 9:109388197-109388219 CTGGTGGGTGGTGATGTGGACGG + Intronic
1060811897 9:126614852-126614874 GTGGCGGGTGGCAGGGGTGATGG + Intronic
1060972194 9:127744687-127744709 CTGGAAGGTGGCCGGGTTGAAGG + Exonic
1061218442 9:129235375-129235397 GTGGGGGGTGGGGGTGGTGACGG - Intergenic
1062081274 9:134625002-134625024 CTGGCGGGTGGGTGTCTGGAGGG - Intergenic
1190099708 X:47513264-47513286 CGCGCGGGTGCCGGTGGTGACGG + Intergenic
1190993674 X:55582236-55582258 CAGGAGGGTGGAAGTGTTGAAGG + Intergenic
1195797896 X:108672108-108672130 CTGGTTGATGGAGGTGTTGACGG - Intronic
1200122551 X:153798007-153798029 CTGGCGTGTGGGGGTGGGGAGGG - Intronic