ID: 1033200012

View in Genome Browser
Species Human (GRCh38)
Location 7:139360252-139360274
Sequence CGCCGCCGCCATGTCGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 102}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033200002_1033200012 -2 Left 1033200002 7:139360231-139360253 CCCCCGCCCGTCCGCCCGCTACG 0: 1
1: 0
2: 4
3: 20
4: 242
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200001_1033200012 1 Left 1033200001 7:139360228-139360250 CCACCCCCGCCCGTCCGCCCGCT 0: 4
1: 1
2: 12
3: 115
4: 830
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200004_1033200012 -4 Left 1033200004 7:139360233-139360255 CCCGCCCGTCCGCCCGCTACGCC 0: 1
1: 0
2: 2
3: 21
4: 203
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200006_1033200012 -8 Left 1033200006 7:139360237-139360259 CCCGTCCGCCCGCTACGCCGCCG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199998_1033200012 13 Left 1033199998 7:139360216-139360238 CCGGTCTGCGCCCCACCCCCGCC 0: 1
1: 0
2: 7
3: 87
4: 754
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199992_1033200012 30 Left 1033199992 7:139360199-139360221 CCCCAGCCCAAAAGGGCCCGGTC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199994_1033200012 28 Left 1033199994 7:139360201-139360223 CCAGCCCAAAAGGGCCCGGTCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200003_1033200012 -3 Left 1033200003 7:139360232-139360254 CCCCGCCCGTCCGCCCGCTACGC 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200005_1033200012 -5 Left 1033200005 7:139360234-139360256 CCGCCCGTCCGCCCGCTACGCCG 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199999_1033200012 3 Left 1033199999 7:139360226-139360248 CCCCACCCCCGCCCGTCCGCCCG 0: 2
1: 1
2: 13
3: 122
4: 864
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199997_1033200012 14 Left 1033199997 7:139360215-139360237 CCCGGTCTGCGCCCCACCCCCGC 0: 1
1: 0
2: 2
3: 57
4: 482
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199995_1033200012 24 Left 1033199995 7:139360205-139360227 CCCAAAAGGGCCCGGTCTGCGCC 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200000_1033200012 2 Left 1033200000 7:139360227-139360249 CCCACCCCCGCCCGTCCGCCCGC 0: 1
1: 0
2: 21
3: 123
4: 813
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033200007_1033200012 -9 Left 1033200007 7:139360238-139360260 CCGTCCGCCCGCTACGCCGCCGC 0: 1
1: 0
2: 0
3: 30
4: 222
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199993_1033200012 29 Left 1033199993 7:139360200-139360222 CCCAGCCCAAAAGGGCCCGGTCT 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102
1033199996_1033200012 23 Left 1033199996 7:139360206-139360228 CCAAAAGGGCCCGGTCTGCGCCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033200012 Original CRISPR CGCCGCCGCCATGTCGGCGC AGG Exonic
900349813 1:2228934-2228956 CGCGGCCGCGGTGCCGGCGCCGG + Exonic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
900969278 1:5980542-5980564 CGCAGCTGCCATGTGGGGGCGGG + Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
903492903 1:23743306-23743328 CGCGGCCGCCGGGTGGGCGCTGG + Exonic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
917846668 1:179025957-179025979 CGCCGCCGCCACAGCGGCTCCGG - Exonic
924230478 1:241958227-241958249 CGCCGCCGCCTCGTCCTCGCTGG - Intergenic
1073196181 10:101694292-101694314 CGCCGCGGCCTGGTCGGCCCAGG - Intronic
1074866126 10:117545338-117545360 CGCAGCCGCCCTGGCGCCGCGGG - Intronic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1077043879 11:535921-535943 CGGCGCCGCGCTGCCGGCGCAGG - Intronic
1077495918 11:2886344-2886366 CGCCGCTGCCAGCTCGGCCCTGG + Intergenic
1078313628 11:10272247-10272269 CGCCGCCGCCATGTCCTCCGGGG - Intronic
1079237108 11:18698877-18698899 CGCCGCCGCCATGGTGTCCCCGG + Exonic
1079451204 11:20601262-20601284 CGCCGCCGCCACGTGTGCCCAGG + Exonic
1084177074 11:67428535-67428557 CACGGCCGCCATGGCGGCGCCGG - Exonic
1092256314 12:6928249-6928271 CGCCGCCGCGACGACGGCGGCGG - Intronic
1100469028 12:94873764-94873786 CGCGGCCGCCAAGCCGGCGGGGG + Intergenic
1101788125 12:107903894-107903916 GGCCATCGCCAAGTCGGCGCCGG - Intergenic
1103433031 12:120904135-120904157 CGCCGCCGCCATGTTGGGTTTGG - Exonic
1103595552 12:122022571-122022593 CGCCGCCGGCATCGCGGCCCCGG - Intronic
1104030969 12:125065575-125065597 CGCCGCCGCCATGTCCAAGGAGG + Exonic
1110558390 13:76885714-76885736 GGCCGCCGCCCTCGCGGCGCGGG - Exonic
1110596592 13:77326794-77326816 CGCCGCCGCCTCGTCCCCGCGGG + Intronic
1113378534 13:109784448-109784470 CGCCGCCGCCGTCTCGGGCCGGG + Exonic
1119500927 14:75126909-75126931 GGCCGCCGCCATGTCGGTGCTGG - Exonic
1120953525 14:90062307-90062329 CGCCGCCGTCTTCTCCGCGCTGG + Exonic
1122183504 14:99972002-99972024 CGCCGCCGCCGGGTCGCCCCTGG + Intronic
1122798525 14:104218304-104218326 CGCTGCCACCATGTGGGCTCTGG - Intergenic
1125626834 15:41115990-41116012 CGCCGCCGCGACGGCGGCGGAGG + Exonic
1126034951 15:44537184-44537206 CGCCGCCGCCATCTCGAGCCGGG - Exonic
1128145183 15:65329008-65329030 GGCAGCCGCCAGGCCGGCGCAGG + Exonic
1129440621 15:75578735-75578757 CTCCGGCGCCATGTCGGGCCGGG + Exonic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1132055627 15:98648833-98648855 CGCCGCCGCCTGCTCTGCGCGGG - Intergenic
1132580082 16:680694-680716 CGCCGCCGCCCTCCCCGCGCGGG - Intronic
1136625491 16:31459514-31459536 CGCAGCCGCCATCTTGGCTCGGG - Exonic
1137261086 16:46830869-46830891 GGCCGCCGCCAGGTGGACGCTGG + Intronic
1137454772 16:48609960-48609982 CGCGCCCGCCATGGCGGCCCGGG - Exonic
1138657940 16:58501421-58501443 CCCCGCCTCCAGGTAGGCGCAGG - Intronic
1141608759 16:85169900-85169922 GGCGGCCGCCGTGGCGGCGCCGG + Intergenic
1144656890 17:17042606-17042628 CGCCGCCGCCCGGCCGCCGCGGG - Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1146438902 17:32876860-32876882 CGCTGGCGCCATGGCGGAGCAGG - Exonic
1147161786 17:38572833-38572855 GGCCGCCGCCGTGCCGGCCCGGG + Intronic
1152607755 17:81301611-81301633 TGCAGCAGCCATGTCGGCGGTGG - Intergenic
1153040987 18:812540-812562 CCCCGCCGCCATGTTGGGTCGGG - Exonic
1158458834 18:57630276-57630298 CGGCGCCGCCATGTTGTCTCCGG + Intergenic
1160818510 19:1047263-1047285 GGCCGCAGCCAGGTTGGCGCGGG - Exonic
1161309619 19:3586422-3586444 CGCAGCCACCCTGTCTGCGCAGG - Intronic
1161973337 19:7595992-7596014 CGCCTCCACCATGGCGGCGCCGG - Exonic
1163473483 19:17511663-17511685 CGCCCTCGCCATGGCCGCGCCGG + Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1168100244 19:54137752-54137774 CGCCGCCGCCATCTTGGACCGGG + Intronic
1168315006 19:55481216-55481238 GGCCGGCGCCATGTCCGCGTGGG - Exonic
1168544688 19:57240674-57240696 GGCCGCCTCCCTGGCGGCGCTGG + Intronic
927713811 2:25340897-25340919 CGGCGCCGCAATGTGGGGGCGGG - Intronic
929252918 2:39779228-39779250 CGCCTCCGACATGGCGGCTCAGG + Exonic
942034757 2:171999959-171999981 GGGCGCCGCCATGTTGGCGTCGG - Exonic
947885568 2:233566744-233566766 GGGCGCCGCCATGTTGGCGAGGG + Intronic
948610653 2:239164372-239164394 GCCGGCCGTCATGTCGGCGCAGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1175847269 20:62065458-62065480 CGCCGCCCCCTTGTCCCCGCAGG - Exonic
1176194524 20:63831132-63831154 CGCGGCCGCCGGGCCGGCGCCGG + Intronic
1179882677 21:44300096-44300118 GGCCGCCGCCATGGCCGCGGTGG + Exonic
1180159616 21:45993212-45993234 GGCCGCCGGCATCTCGGCTCTGG - Intronic
1183466697 22:37983773-37983795 CTCCTCCGCCATGTCGCCCCCGG + Exonic
1184136573 22:42553647-42553669 GGCCGCCCCCACGTCCGCGCGGG - Intronic
1184759587 22:46537098-46537120 CGCCGCCGCCCTGCCGGCGATGG - Exonic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
950168038 3:10816255-10816277 CTCCGCCGTCATGGCCGCGCTGG - Exonic
954063583 3:48088774-48088796 CGCCGCCGCCGAGACGGAGCTGG + Exonic
954437441 3:50503532-50503554 CGCCGCCGCCTTCTCCGCGAGGG + Intronic
956761300 3:72447208-72447230 CGCCTCCGCCCTCGCGGCGCCGG - Intergenic
962498629 3:135966489-135966511 GGCGGCGGCCAGGTCGGCGCGGG - Intronic
963904481 3:150762726-150762748 CGCCGCCACCATCTCGGCTGCGG - Exonic
968613166 4:1566194-1566216 TGCCGCCTCCATGTCAGCTCAGG - Intergenic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
977607387 4:98996094-98996116 CGCCGCGGCCATGTGGGCTGGGG + Intronic
986473695 5:8101921-8101943 AGCCGCCGTCAAGTAGGCGCTGG + Intergenic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
990799770 5:59587536-59587558 CGCAGCCGCCTTGTCTGCCCTGG + Intronic
997329870 5:133052241-133052263 AGCCGGCGCCATGTCGGTGGTGG + Exonic
1000082175 5:157858799-157858821 GGCCGCCGCCATGATGGGGCTGG + Intronic
1006642874 6:35497540-35497562 CGCAGCCGCCAGGGCGGAGCCGG - Intergenic
1008649065 6:53544942-53544964 CGCCGCCGCCGCATCGGAGCGGG - Exonic
1015935660 6:138404289-138404311 CGCCGCCACCAAGGCGGGGCCGG - Exonic
1019177126 6:170165629-170165651 AGCCGCCGGCATGACGACGCTGG - Intergenic
1023722789 7:43113113-43113135 CGCCGCCGCCCGGTCCGGGCCGG + Intronic
1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG + Exonic
1034455462 7:151167653-151167675 CCCCGCCGCCACCTCGGCCCGGG - Intronic
1037840961 8:22245096-22245118 GGGCGCCGCCATCTTGGCGCGGG - Intronic
1041107044 8:54454131-54454153 CACCGCCGCCTAGACGGCGCCGG + Intergenic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1043502787 8:80873795-80873817 CGCCGCCGCCGCCTCGTCGCCGG - Intronic
1045112704 8:98949155-98949177 CGCCGCCGCCATCTCCGTGATGG - Exonic
1045516307 8:102863662-102863684 CGCCGCCGCCATGTTCGAGGCGG + Intronic
1049585190 8:143429772-143429794 CACCACCACCATGGCGGCGCGGG - Exonic
1053399049 9:37801184-37801206 CGCCGAGGCCGTGTCGGCCCCGG - Exonic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057401442 9:94726794-94726816 CCCCGCCGCCATCCCGACGCCGG - Intronic
1057806143 9:98221148-98221170 AGCCGCCGCCAGGTATGCGCTGG + Exonic
1059123308 9:111661625-111661647 CGCCGCCGCCATGTCCTCCGGGG + Exonic
1061196878 9:129111410-129111432 GACGGCCGCCATGTCGGTGCGGG - Exonic
1061208545 9:129177761-129177783 CGCCGCCGCCAAGTTGGAGCGGG + Exonic
1062491664 9:136807939-136807961 CAGCGCCGCCATCTTGGCGCCGG - Exonic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1189325234 X:40107647-40107669 CGCGGCCGACTTGGCGGCGCTGG + Intronic
1200092774 X:153643591-153643613 GGCCGCCTCCATTTCAGCGCCGG - Intronic