ID: 1033209243

View in Genome Browser
Species Human (GRCh38)
Location 7:139448284-139448306
Sequence GGAGAAATGTTGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033209243_1033209247 7 Left 1033209243 7:139448284-139448306 CCACACCTGGCCAACATTTCTCC No data
Right 1033209247 7:139448314-139448336 AAAACCTCCTCTTTGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033209243 Original CRISPR GGAGAAATGTTGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr