ID: 1033210090

View in Genome Browser
Species Human (GRCh38)
Location 7:139453978-139454000
Sequence CAGGCCGCGAGCATGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033210081_1033210090 15 Left 1033210081 7:139453940-139453962 CCAAATAAAGAGTGAAGCGACAG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1033210090 7:139453978-139454000 CAGGCCGCGAGCATGGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 68
1033210080_1033210090 16 Left 1033210080 7:139453939-139453961 CCCAAATAAAGAGTGAAGCGACA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1033210090 7:139453978-139454000 CAGGCCGCGAGCATGGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033210090 Original CRISPR CAGGCCGCGAGCATGGGCGT GGG Intronic
901084864 1:6604067-6604089 CAGGCCACGCGCATGGGAGCTGG + Intronic
904320643 1:29695793-29695815 GAGGCTGAGAGCATGGGCTTCGG + Intergenic
908021066 1:59899422-59899444 CAGGGGGAGAGCATGGGCTTTGG + Intronic
908838108 1:68249197-68249219 GAGGCAGAGAGCATGGGAGTCGG + Intergenic
920458054 1:206116238-206116260 CAGGCCGTGAGCATGGTCACCGG + Exonic
921595487 1:217049695-217049717 CAGGCCGCAACCATGGGCCAAGG - Intronic
1064075367 10:12264413-12264435 CAGGCCACGAGCAGGGGCGGGGG + Intergenic
1065102122 10:22341073-22341095 CAGGCCGGGAGCGCGGGCGGGGG - Intergenic
1068682144 10:59831691-59831713 CAGGACGCTAGCATGGGTGAAGG + Intronic
1075207076 10:120457177-120457199 CAGGCCGCGGGCGGGGGCGGAGG - Exonic
1075792480 10:125094941-125094963 CAGACGACGAGCATGGGGGTGGG + Intronic
1076846789 10:133073150-133073172 CAGGCCGTGAGCTTGGTCGGTGG + Intronic
1076998348 11:310381-310403 CAGGCCGCGAGCGTGGCCTTGGG - Intronic
1077000394 11:319377-319399 CAGGCCGCGAGCGTGGCCTTGGG + Intergenic
1079245847 11:18751662-18751684 CAGGCAGGCAGGATGGGCGTGGG + Intronic
1083813195 11:65116970-65116992 CAGGGCGAGAGTATGCGCGTAGG + Exonic
1083891855 11:65599543-65599565 CAGGGCGCGGGCGTTGGCGTGGG + Exonic
1084102220 11:66957387-66957409 CAGGCCGCTCGCTTGAGCGTAGG + Intronic
1084150859 11:67287329-67287351 CAGGCCTCCAGCATTGGTGTGGG + Intergenic
1085666237 11:78417710-78417732 CAGGCCGGCAGCATGAGCGGCGG - Exonic
1089345417 11:117788193-117788215 CAGGCAGAGAGCATGGGACTTGG - Intronic
1096241362 12:49961871-49961893 CAGGCCGCCAGCCTCGGAGTGGG + Exonic
1096653225 12:53072456-53072478 CAGGCCAGGAGCAAGGGGGTAGG + Intronic
1104588249 12:130064324-130064346 CAGGGCTAGAGCATGGACGTGGG + Intergenic
1104754722 12:131261918-131261940 CAGGCCCCGTGGATGGGCGGGGG - Intergenic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1109468708 13:62775892-62775914 CAGGCAACGAGCATGGGTGAAGG + Intergenic
1114219152 14:20681991-20682013 CAGTCCGCAAGCCAGGGCGTGGG - Intergenic
1122084456 14:99290032-99290054 CAGGTCCCGAGGATGGGCGAAGG + Intergenic
1122230745 14:100305489-100305511 CATGCCCCGACCGTGGGCGTCGG - Intronic
1124029935 15:26001421-26001443 GAAGCCGCGAGAATGGCCGTAGG + Intergenic
1131508083 15:93033569-93033591 CAGGCTGAGAGCATGGGCTCTGG + Intergenic
1132748657 16:1447362-1447384 CAGGGCATGGGCATGGGCGTGGG - Intronic
1135166080 16:20140392-20140414 CAGGCCCTGAGCATGGGCTAAGG - Intergenic
1136568000 16:31081378-31081400 CAGGCTGCCAGCATGGCGGTAGG - Exonic
1136932465 16:34431832-34431854 CAGGCCTCGCGCATGCGCATTGG - Intergenic
1136972107 16:34979982-34980004 CAGGCCTCGCGCATGCGCATTGG + Intergenic
1147326454 17:39672069-39672091 AGGGCCGTGAGCATGGGCCTGGG - Exonic
1148685031 17:49496270-49496292 GAGGCCGCGAGCAGGAGCGCGGG - Intronic
1160497719 18:79384926-79384948 CAGGCCGGGAGCAAGGGTGGGGG - Intergenic
1160613911 18:80109582-80109604 CAGGCGGCGGGCGTGGGTGTGGG - Intronic
1162298247 19:9828096-9828118 CAGGCGGCGAGAAGGGGCGGAGG + Intronic
1162493621 19:11010419-11010441 CAGGCCACGTGCAAGGGCCTGGG - Exonic
1163144997 19:15373953-15373975 CAGGCCGCCATCATTGGCCTTGG + Exonic
933782582 2:85812517-85812539 CAGCCAGCGAGCTTGGGGGTGGG - Intergenic
937418522 2:121736704-121736726 CAGGCTGCGAGCGGGGGCGATGG - Intronic
1171997051 20:31739507-31739529 CAGGGTGCGAGCAGGGGCTTCGG + Exonic
1173279747 20:41618009-41618031 CGGGCCGCGCGCAGGGGCGGGGG - Intronic
1175485196 20:59340745-59340767 CAGGCCTAGAGGAGGGGCGTTGG + Intergenic
1179591983 21:42415000-42415022 CAGGCTGAGAGCATGGGCCATGG - Intronic
1181846245 22:25711753-25711775 CAAGCTGCCAGCATGGGGGTAGG - Intronic
1184000082 22:41666889-41666911 CAGGCCGGGTGCCTGGGCCTGGG + Intergenic
1184259960 22:43309102-43309124 CAGGGGGCGAGCCTGGGCCTGGG - Intronic
949970445 3:9398381-9398403 AAGGCCGCGAGAACGGGGGTAGG - Intronic
950429865 3:12944522-12944544 CAGGCCTGGAGCAGAGGCGTGGG - Intronic
954283310 3:49600224-49600246 CAGGCCTTGAGCCTGGGCCTGGG + Intronic
976956400 4:90905752-90905774 CAGGCCCCGAGCAAAGGAGTGGG - Intronic
1001170313 5:169413290-169413312 CAGGTGGTGAGCATGGGGGTTGG + Intergenic
1017672431 6:156779334-156779356 GCGGCCGCGGGCATGGGCTTGGG + Exonic
1018872280 6:167792300-167792322 CAGGCTGCGGGCATGGCTGTGGG + Intronic
1019370292 7:659622-659644 CAGGCCGCGACCATGGACACCGG + Intronic
1019514056 7:1432067-1432089 GAGGCTGTGAGGATGGGCGTGGG - Intronic
1023067208 7:36389804-36389826 CGAGCCGCGAGCATGCGCGCTGG - Exonic
1023993842 7:45146654-45146676 CAGGCCGGGAGCAGGGCCGTGGG + Intergenic
1032002816 7:128276277-128276299 CAGACCTGGAGCATGGGCCTGGG + Intergenic
1033210090 7:139453978-139454000 CAGGCCGCGAGCATGGGCGTGGG + Intronic
1034879097 7:154750100-154750122 CAGGCCAGGAGCAAGGGTGTGGG - Intronic
1043744204 8:83853114-83853136 CAGGCTGTGAGCATGGGCAATGG - Intergenic
1045108890 8:98920703-98920725 CAGGCAGTGAGCATGGCTGTAGG - Intronic
1059149915 9:111940005-111940027 CAGGCCGGGCGCAGGGGCTTAGG - Intergenic
1060522481 9:124301519-124301541 CAGGCTGCCAGCATGGGTATAGG + Intronic
1061553151 9:131349614-131349636 CAGCCCTCGAGCCTGGGCTTGGG - Intergenic
1203787218 EBV:134720-134742 CGCGCCGCAAGCATGGGCGAGGG - Intergenic
1192533234 X:71907611-71907633 CAGGCCTGGAGCATGGGAGTTGG + Intergenic