ID: 1033210876

View in Genome Browser
Species Human (GRCh38)
Location 7:139459454-139459476
Sequence GGTCCCACCTACATTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033210865_1033210876 30 Left 1033210865 7:139459401-139459423 CCCGCCCTGCTTGGCTCCTGGCC 0: 1
1: 0
2: 10
3: 114
4: 875
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75
1033210870_1033210876 14 Left 1033210870 7:139459417-139459439 CCTGGCCCTAACTCTAGGCACTC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75
1033210868_1033210876 25 Left 1033210868 7:139459406-139459428 CCTGCTTGGCTCCTGGCCCTAAC 0: 1
1: 0
2: 3
3: 13
4: 205
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75
1033210867_1033210876 26 Left 1033210867 7:139459405-139459427 CCCTGCTTGGCTCCTGGCCCTAA 0: 1
1: 0
2: 0
3: 34
4: 271
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75
1033210866_1033210876 29 Left 1033210866 7:139459402-139459424 CCGCCCTGCTTGGCTCCTGGCCC 0: 1
1: 0
2: 9
3: 93
4: 726
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75
1033210871_1033210876 9 Left 1033210871 7:139459422-139459444 CCCTAACTCTAGGCACTCTAGAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75
1033210872_1033210876 8 Left 1033210872 7:139459423-139459445 CCTAACTCTAGGCACTCTAGAGA 0: 1
1: 0
2: 1
3: 14
4: 106
Right 1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG 0: 1
1: 0
2: 2
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033210876 Original CRISPR GGTCCCACCTACATTCCTAC AGG Intronic
900688835 1:3966983-3967005 GGTCCCACCCACATTCCAAGTGG - Intergenic
904277170 1:29392199-29392221 GGTCCTCACTACAGTCCTACAGG - Intergenic
905336779 1:37250025-37250047 AGACCCACCTACATTCCTTGGGG + Intergenic
906045670 1:42829092-42829114 TGTCCCACCCACTTTCCTATAGG - Intronic
911443106 1:97954437-97954459 GGTACCACCTACCTTACCACAGG - Intergenic
913043955 1:115057554-115057576 GGTCCAACCTACATGCCCAAAGG - Exonic
914710254 1:150206590-150206612 GTTCCCATCTAAATTCCCACTGG - Intergenic
915080519 1:153348825-153348847 GGTCCCACTTGCATTTCTCCAGG - Intronic
915243088 1:154537714-154537736 GGTCCCACCTCCAAGCCTTCTGG + Intronic
916542847 1:165773745-165773767 GCTCACACCTACAGTCCCACTGG - Intronic
918342431 1:183578801-183578823 GGTCCCACCTACATGCCTGTGGG - Intronic
1063889682 10:10616873-10616895 GGTCCCAGCTACATGCGTAATGG - Intergenic
1068028266 10:51675956-51675978 GGTCCCACCTTCTTTCATAAGGG - Intronic
1069996496 10:72345030-72345052 GGTCCCACCTGCTTTCCTGTGGG + Exonic
1075401158 10:122162766-122162788 GGTGTCACGGACATTCCTACAGG + Intronic
1075816979 10:125271925-125271947 GGTCCTGCCTACAATCCCACAGG + Intergenic
1077308875 11:1879813-1879835 AGTCCCACCTTCATCCCCACAGG + Intronic
1078536538 11:12179437-12179459 TGTCCCACCTAAACTCCCACTGG + Intronic
1087535885 11:99444827-99444849 AGTCCCACCTCTTTTCCTACAGG + Intronic
1097738437 12:63209824-63209846 GATGCCACCTGCATTCCTTCTGG - Intergenic
1100498852 12:95153705-95153727 GTTCTCATCTACATTCCTATTGG - Intronic
1103816227 12:123659083-123659105 GATCCCTCCTACATTGCTGCTGG + Intronic
1105723927 13:23142351-23142373 GGTCTCAGCTGCCTTCCTACGGG + Intergenic
1114346145 14:21797345-21797367 GGTTCCAGCCACTTTCCTACTGG + Intergenic
1117775941 14:59184584-59184606 GGCCACACCTACACACCTACTGG - Intergenic
1120253193 14:82085410-82085432 GGTCCCTCCTTCATTCCTCTGGG + Intergenic
1121473795 14:94175332-94175354 GGTCCCAGCTACAGTCCTGGAGG - Intronic
1128539404 15:68515907-68515929 GCTCCCACCTACCTCCCTAGAGG + Intergenic
1133321810 16:4918827-4918849 TGCCCCACCCACATTCCTGCTGG - Intronic
1141850917 16:86645446-86645468 GGTCTCACGTCCATACCTACTGG - Intergenic
1144875955 17:18397363-18397385 GGATCCACCCACATTCCTGCGGG - Intergenic
1145156273 17:20547057-20547079 GGATCCACCCACATTCCTGCGGG + Intergenic
1146519854 17:33517907-33517929 GTTCCCACCCACATTGCAACAGG - Intronic
1152132388 17:78485115-78485137 GGTCCCACCTTCTGTCCTCCGGG - Intronic
1152335817 17:79699854-79699876 GGACCCACCCACATTCATGCTGG + Intergenic
1156234521 18:35188979-35189001 GGTCATACCTACATGCCAACTGG - Intergenic
1161068578 19:2249734-2249756 GGCCCCACATACCTTCCTCCAGG - Exonic
1161120897 19:2525635-2525657 GGTCCCACCTCCCTCCCTGCCGG - Intronic
1161925383 19:7295182-7295204 GGTTCCACCTACCTTACTGCAGG + Intergenic
1165210475 19:34231744-34231766 GGTGACACCTGCACTCCTACAGG - Intergenic
1168079512 19:53999192-53999214 GGTTCAGCCTAAATTCCTACTGG + Intronic
930693468 2:54387921-54387943 GAGCCCACCTCCAGTCCTACAGG + Intergenic
931771525 2:65501958-65501980 GGTCCCACCTGCTTTCCTGTGGG + Intergenic
933682199 2:85112051-85112073 GGTTTCCCATACATTCCTACAGG - Intergenic
936722277 2:115267028-115267050 GTTCCCACCTCCAGTCCTATAGG + Intronic
937908598 2:127064632-127064654 GGTCCCCCTGACATTCCTAGAGG - Intronic
949080466 2:242094250-242094272 AGTCCCAACTACTTTCCTGCAGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1181431395 22:22883957-22883979 GGTCCTACCCACAGTCCCACAGG + Intronic
1184606798 22:45579067-45579089 GTTCCCACCTACATCCTTCCTGG + Intronic
1185049554 22:48546685-48546707 GGGCTCACCTCCATTCCTCCAGG + Exonic
952355027 3:32576104-32576126 GGTCTCACTTACATTCTTAAAGG - Intergenic
952726885 3:36595987-36596009 GATACCACCTACATGCCTATTGG + Intergenic
952786911 3:37164842-37164864 GGACCCACCTACATTCATGGGGG - Intronic
953560996 3:43993701-43993723 GATCACACCTACATTGCTGCTGG + Intergenic
959533226 3:107457212-107457234 GGTTCCACTTACTTTTCTACTGG - Intergenic
966160524 3:176962799-176962821 AATCCCACCTCCATTCTTACAGG + Intergenic
973847293 4:54925997-54926019 GGTCCCACCTACATTATCAAGGG + Intergenic
985715795 5:1460336-1460358 GGTCCCACCTTCATTTCTCCTGG + Intronic
986618797 5:9648569-9648591 GGCCCCACATTCATTCATACTGG + Intronic
992096491 5:73367810-73367832 GGTTCCAACCACATTCCTGCAGG - Intergenic
997862028 5:137426999-137427021 GGTCCCACCTACATGCAGAGGGG - Intronic
999085083 5:148880904-148880926 CTTCCCACCTACTTTCCTGCTGG - Intergenic
1003747072 6:9014531-9014553 TGTCCCAACTACATTCCTACTGG + Intergenic
1008345353 6:50420321-50420343 GATCCCTCCTACATTCCTGGTGG + Intergenic
1015872789 6:137794024-137794046 AGTGCCACCTACATTCCAAAAGG + Intergenic
1019525184 7:1477538-1477560 GGTGCCACCCACCTTCCTCCGGG + Exonic
1019744516 7:2692186-2692208 GGTCCCACCTGTCTTCCTCCAGG - Intronic
1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG + Intronic
1035538516 8:412442-412464 AGTCCCAACTACTTTCCTCCAGG + Intronic
1043834470 8:85031444-85031466 GGGCCCACCTACACTCCAGCTGG + Intergenic
1044941918 8:97352297-97352319 GATTCCACCAACATTCCTAATGG + Intergenic
1045636177 8:104193547-104193569 GCTCTCATCTACCTTCCTACCGG + Intronic
1054852236 9:69859617-69859639 TGACCCACCTAGATTCCTCCAGG - Intronic
1055398454 9:75897889-75897911 GGTCCCATCTATATTCCTCATGG - Intronic
1056121727 9:83494792-83494814 AGTCCCAGCTACATTTATACTGG + Intronic
1056797786 9:89670459-89670481 CGTCCCACCTACAGTCCTGAGGG + Intergenic
1185829089 X:3281665-3281687 TGTTCCACCAACATTCCTACAGG + Intronic
1190059741 X:47203041-47203063 GGTCCCACCCACATACCTGGAGG - Exonic
1192434893 X:71137041-71137063 GGTCCCTCCAGCATTCCTAGTGG - Intronic
1198158902 X:133987602-133987624 TGTCTCACCTAAACTCCTACTGG - Intergenic
1201249200 Y:12039230-12039252 GGTTCCACCAACATTCCTACAGG - Intergenic