ID: 1033213989

View in Genome Browser
Species Human (GRCh38)
Location 7:139481032-139481054
Sequence AAGGCTCCTGAAGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 501}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033213989_1033213997 18 Left 1033213989 7:139481032-139481054 CCGTGCCCAGCTTCAGGAGCCTT 0: 1
1: 0
2: 3
3: 37
4: 501
Right 1033213997 7:139481073-139481095 CAGGTGGTGAGCATCAGAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1033213989_1033213993 -9 Left 1033213989 7:139481032-139481054 CCGTGCCCAGCTTCAGGAGCCTT 0: 1
1: 0
2: 3
3: 37
4: 501
Right 1033213993 7:139481046-139481068 AGGAGCCTTATATGTGGAAGAGG No data
1033213989_1033213995 -1 Left 1033213989 7:139481032-139481054 CCGTGCCCAGCTTCAGGAGCCTT 0: 1
1: 0
2: 3
3: 37
4: 501
Right 1033213995 7:139481054-139481076 TATATGTGGAAGAGGAAGACAGG No data
1033213989_1033213998 25 Left 1033213989 7:139481032-139481054 CCGTGCCCAGCTTCAGGAGCCTT 0: 1
1: 0
2: 3
3: 37
4: 501
Right 1033213998 7:139481080-139481102 TGAGCATCAGAAGTGGCAGCAGG No data
1033213989_1033213999 28 Left 1033213989 7:139481032-139481054 CCGTGCCCAGCTTCAGGAGCCTT 0: 1
1: 0
2: 3
3: 37
4: 501
Right 1033213999 7:139481083-139481105 GCATCAGAAGTGGCAGCAGGAGG No data
1033213989_1033213996 2 Left 1033213989 7:139481032-139481054 CCGTGCCCAGCTTCAGGAGCCTT 0: 1
1: 0
2: 3
3: 37
4: 501
Right 1033213996 7:139481057-139481079 ATGTGGAAGAGGAAGACAGGTGG 0: 1
1: 0
2: 11
3: 92
4: 799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033213989 Original CRISPR AAGGCTCCTGAAGCTGGGCA CGG (reversed) Intronic
900342517 1:2195562-2195584 AAAGCTGCTGGGGCTGGGCAGGG - Intronic
900343830 1:2201427-2201449 AAGGGACCTGAGGCTGGGCACGG + Intronic
900397039 1:2457303-2457325 AAGGCCCCTGAAGCCCAGCAGGG - Intronic
900605947 1:3523576-3523598 CAGGCTCCCCAAGCTGGGCAGGG + Intronic
901211187 1:7526925-7526947 CAGGCCCCAGCAGCTGGGCAAGG - Intronic
901485945 1:9561751-9561773 ATGACTCCTGAAGCTGAACAGGG + Intronic
901909480 1:12444129-12444151 ATGTTTTCTGAAGCTGGGCACGG - Intronic
902121932 1:14173669-14173691 TAGGCTCCTCAAGTTGGGCGGGG - Intergenic
902613185 1:17609071-17609093 AAGGAGCTTGAGGCTGGGCATGG - Intronic
902623128 1:17661862-17661884 AAGGCCTCTGCAGCTGGGCCTGG - Intronic
902766415 1:18619128-18619150 AAGGCTGGTGGAGCTGGGCAGGG - Intergenic
903235818 1:21950137-21950159 CAGGTCCCTGAGGCTGGGCACGG + Intergenic
903272085 1:22195976-22195998 AAGGCTCTTGATCCTTGGCATGG + Intergenic
903770275 1:25759425-25759447 AGGGCTCCAGAGGATGGGCAGGG - Intronic
903823442 1:26122224-26122246 ATGGCTCCTGAAGTTTGGGAAGG + Exonic
904277255 1:29392558-29392580 GAGCAGCCTGAAGCTGGGCAGGG - Intergenic
904960457 1:34328544-34328566 AAGCCTCCTGAAGCAGAACAGGG - Intergenic
904993055 1:34609234-34609256 AAGGCTCCTGAACCTGGCTCTGG - Intergenic
905164997 1:36075481-36075503 AAAGTACCTGAGGCTGGGCATGG + Intergenic
905288810 1:36907520-36907542 AAGGCGACAGAAGATGGGCATGG + Intronic
906194959 1:43924272-43924294 AAGGCACGTGAAGCATGGCAGGG - Intronic
907268107 1:53275021-53275043 AAGCCTCATGTAGCTGGGCAGGG + Intronic
907305094 1:53508893-53508915 AAGGCTCGCAAAGCTGTGCAAGG + Intronic
908357565 1:63337641-63337663 ATGGCTGGTCAAGCTGGGCATGG + Intergenic
909349177 1:74629582-74629604 TGGGCTTCTGTAGCTGGGCATGG - Intronic
909389534 1:75103995-75104017 AAAGTCCCTGAGGCTGGGCATGG + Intergenic
909441926 1:75705966-75705988 AAAGCTGATGAGGCTGGGCATGG - Intergenic
909602321 1:77473371-77473393 GAAGCTTCTGAGGCTGGGCATGG - Intronic
911422676 1:97663718-97663740 AAGTCTCCTGAATCTGGTCCTGG + Intronic
911808017 1:102235243-102235265 AGGGCTCCTCAAGCGTGGCAAGG + Intergenic
912715932 1:111983524-111983546 AAGGGTTGTGAGGCTGGGCAGGG + Intronic
913203630 1:116516182-116516204 AAGGGTTATGAAGCTGGGTATGG - Intronic
914749889 1:150527590-150527612 AAAGCACCAGAGGCTGGGCATGG + Intergenic
915114354 1:153586788-153586810 AAGCATCCTAAGGCTGGGCATGG + Intergenic
915732878 1:158066697-158066719 AAGGCACCAGAAGCTGGGGTGGG - Intronic
916067719 1:161150002-161150024 AAGGCTTATAAGGCTGGGCATGG - Intergenic
916452691 1:164936130-164936152 AAGGCTCTCGGAGATGGGCAAGG + Intergenic
916935715 1:169626289-169626311 AAGCCAACGGAAGCTGGGCACGG + Intronic
920066342 1:203272572-203272594 AGGGCTCCTGAAGCCAGGCCAGG - Intronic
920212019 1:204335279-204335301 ATGGCTCAGGCAGCTGGGCAGGG + Intronic
920404966 1:205702123-205702145 GGGGCTCCTTAAGCTAGGCAGGG + Intergenic
921042712 1:211448903-211448925 GAGCCACCTAAAGCTGGGCATGG - Intergenic
921607818 1:217175862-217175884 AAGCCTGCTTAGGCTGGGCACGG - Intergenic
921992134 1:221378412-221378434 GAGCCTCCTGAAGATGGGCTGGG + Intergenic
923880419 1:238098070-238098092 GAGGCCCCAGAGGCTGGGCATGG - Intergenic
924256116 1:242184656-242184678 AAGACAACTGAGGCTGGGCACGG - Intronic
1063161951 10:3424624-3424646 AATGCTCCTGGAGCTGGGGAGGG + Intergenic
1064221050 10:13440427-13440449 AAGGCACCCGCACCTGGGCAGGG - Intronic
1064612602 10:17118725-17118747 AAGGTACATGAGGCTGGGCACGG - Intronic
1066403453 10:35097098-35097120 AAGGGGCATGAGGCTGGGCACGG - Intergenic
1068753372 10:60622529-60622551 AAGCCTCAGGTAGCTGGGCACGG - Intronic
1069025883 10:63540874-63540896 AAAAATCCTTAAGCTGGGCATGG - Intronic
1069311319 10:67041305-67041327 AAGGCTCCCCAAGCTGCCCAAGG + Intronic
1069417360 10:68212743-68212765 AGTGCTCTTTAAGCTGGGCACGG - Intergenic
1069892896 10:71662924-71662946 GAGCCTCCAGAAGCTGGGAAAGG - Intronic
1069945446 10:71982331-71982353 TAGCCTCCAGAAGCTGGGAAAGG + Intronic
1070349974 10:75582501-75582523 CAGTGTCCTGAGGCTGGGCAGGG + Intronic
1070581586 10:77724584-77724606 CAGTGTCCTGAAGCTGTGCAGGG - Intergenic
1071631597 10:87223019-87223041 AAGGCTCCTGCGGCGGCGCACGG + Intergenic
1071926670 10:90416837-90416859 AAGGCTACTGATGCTGATCAAGG - Intergenic
1072212331 10:93257897-93257919 AAGAAACCTGAGGCTGGGCACGG + Intergenic
1072590444 10:96824066-96824088 AAGACTCAGGAGGCTGGGCATGG + Intergenic
1073116206 10:101093368-101093390 AGGGGCCCTGAAGGTGGGCAAGG - Intronic
1075233485 10:120704865-120704887 AAGGAGCCTGAAGCTCAGCATGG - Intergenic
1075692462 10:124407242-124407264 GAGGTTCCTGAGGCTAGGCAGGG - Intronic
1077147709 11:1053385-1053407 AACCCTCCCGAAGCTGGGCCTGG + Intergenic
1077257237 11:1591856-1591878 AAAGCTCCTCTGGCTGGGCACGG - Intergenic
1077465453 11:2731699-2731721 AAGGCGCCTGAAGCAAGGGAGGG + Intronic
1077564584 11:3289431-3289453 GAGGCTCCTCAGGCTGGCCAAGG + Intergenic
1077570473 11:3335248-3335270 GAGGCTCCTCAGGCTGGCCAAGG + Intergenic
1077662995 11:4085672-4085694 AAGGCACCTGAAACAGGTCATGG - Intronic
1078436235 11:11328056-11328078 AAGGCTGTTTAAACTGGGCATGG + Intronic
1080299367 11:30767532-30767554 AAGCCTCCAGAAGCTGGAAAAGG - Intergenic
1080667077 11:34345376-34345398 AAGGGGCCTGAAGGAGGGCAGGG - Intronic
1081933839 11:46890882-46890904 AAGCATTCTGAGGCTGGGCATGG - Intronic
1081968721 11:47184795-47184817 CAGGCTCCTGAGGCTGGACTGGG - Intronic
1082715163 11:56603264-56603286 AAGGATGCTGAAGCTGTTCATGG - Intergenic
1083475832 11:62914826-62914848 GAGGCCCCTGCAGCAGGGCAGGG - Intronic
1083491991 11:63020271-63020293 CAGGCTTGTGCAGCTGGGCACGG - Intergenic
1083744194 11:64726195-64726217 AAAGGTTCTGAAGCTGGGCCGGG - Intergenic
1084514155 11:69626938-69626960 AACACTCCTGAGGCTGGGAAGGG - Intergenic
1084692418 11:70734906-70734928 AAGGCCCATGAAGCTGGGAATGG + Intronic
1085298131 11:75442479-75442501 AGAGCTCCTGGAGCTGGCCAAGG - Exonic
1085689116 11:78651299-78651321 AAAGCTGCTGCAGCTGTGCAAGG - Intergenic
1086137936 11:83461569-83461591 AAAGCTCATGGAGCTGGGGACGG + Intronic
1086140619 11:83494744-83494766 ATGTCTCCTGAAGTTGAGCAGGG + Intronic
1087470567 11:98568774-98568796 AACACACCTGCAGCTGGGCACGG - Intergenic
1089610972 11:119668596-119668618 AAGGCTCCTGAAGAAGGGGCTGG - Intronic
1091402343 12:188780-188802 ATGGCTCCACAACCTGGGCAAGG - Intergenic
1091462196 12:652438-652460 AAGGAAAATGAAGCTGGGCATGG + Intronic
1092070669 12:5628984-5629006 GATGCTCCTGAAGCGGGGCCAGG - Intronic
1093747343 12:22757224-22757246 AAATCTCCTAAAGCTGGGCCAGG + Intergenic
1094449293 12:30567285-30567307 AAAGTCCCTGAGGCTGGGCATGG - Intergenic
1095267149 12:40173936-40173958 CAGGCTCATGAAGGTGGGGAAGG + Intergenic
1095996152 12:48086745-48086767 AAGGAGGCTGAGGCTGGGCATGG + Intronic
1096443653 12:51668505-51668527 AGTTCTGCTGAAGCTGGGCAGGG + Intronic
1096474813 12:51901989-51902011 AAGGCTTCAGTAGCCGGGCATGG + Intergenic
1096499045 12:52054474-52054496 GAAGGTGCTGAAGCTGGGCAGGG - Exonic
1097088597 12:56487912-56487934 AAGGCTCCTGGGACAGGGCAGGG - Intronic
1097236411 12:57543057-57543079 AAGGTGACTGAGGCTGGGCATGG + Intronic
1097351841 12:58557159-58557181 AAGGCTCCTGCAGCAAGGGAAGG + Intronic
1097563543 12:61239239-61239261 AAGCCACCTAAAGCTGGGGATGG + Intergenic
1097707992 12:62887940-62887962 AATGCTCCTCAAGGTGGTCAAGG + Intronic
1098212617 12:68182349-68182371 AAGCTTCCTGAGGCTGGGCGCGG - Intergenic
1098212967 12:68185721-68185743 ATGGCTCCTGAAGCTTGCCAAGG - Intergenic
1100304360 12:93337015-93337037 AAGGCAGCTGAAGTTGGTCAAGG - Intergenic
1100314979 12:93436749-93436771 AAAGTGACTGAAGCTGGGCATGG - Intronic
1102260143 12:111438401-111438423 AAGGCCCCTCCAGCTGGCCAGGG - Intronic
1104230161 12:126876941-126876963 AAGAGTCCTGAAGCACGGCATGG - Intergenic
1104666899 12:130653895-130653917 CAGTGTCCTGAAGCTGTGCAGGG + Intronic
1105728557 13:23188607-23188629 AAGCCTTCTTAGGCTGGGCATGG - Intronic
1106506553 13:30375734-30375756 CACTCTCCTGATGCTGGGCATGG - Intergenic
1107243572 13:38265807-38265829 TAGGCTTCAGAGGCTGGGCATGG + Intergenic
1107323888 13:39219344-39219366 AAGGATATTGAAGCTGGACATGG + Intergenic
1108802438 13:54116090-54116112 CAGCCTCCTGAAGCCTGGCAAGG - Intergenic
1109172446 13:59113715-59113737 AAAGATTCTGAGGCTGGGCATGG + Intergenic
1109764320 13:66873682-66873704 AAGGCTTGGGAAGCTGGGGATGG - Intronic
1110283810 13:73726141-73726163 AACCCACTTGAAGCTGGGCACGG - Intronic
1110588734 13:77228213-77228235 AATTCTGCTCAAGCTGGGCATGG + Intronic
1111356669 13:87115068-87115090 AAGGCTAATAAGGCTGGGCACGG - Intergenic
1112028963 13:95439622-95439644 GAGGCCCCAGAGGCTGGGCATGG - Intronic
1112115066 13:96343348-96343370 CAGGCTCTAGAAGCTGGGTAAGG - Intronic
1113976283 13:114230156-114230178 TGGCCTCCTGAAGCTGGGAAAGG - Intergenic
1115264565 14:31487726-31487748 AAGCCGCCTGTGGCTGGGCACGG - Intronic
1116436491 14:44900118-44900140 AAAAATCCTGAGGCTGGGCACGG - Intronic
1117454431 14:55883529-55883551 AATGATTCTGAAGCTGGGCCAGG + Intergenic
1117515895 14:56500863-56500885 AAGGCTCCCCAAGCTTTGCAAGG - Intronic
1118718714 14:68578752-68578774 AAGGCACATGGATCTGGGCAGGG - Intronic
1118805006 14:69228480-69228502 AAGGCTAAGGAGGCTGGGCACGG - Intronic
1119231872 14:72986414-72986436 AAGCCTCCTGAAACTTGTCAAGG - Intronic
1119315872 14:73694113-73694135 AAGGAACTTTAAGCTGGGCACGG + Intronic
1121052919 14:90831115-90831137 AAGCCTCCAGAAGGCGGGCAGGG + Intergenic
1122072690 14:99214828-99214850 GTGGCTCCTGAAGCAGGGGAGGG + Intronic
1122402722 14:101476749-101476771 AGGGCTGCTGCAGATGGGCAGGG - Intergenic
1123065667 14:105618092-105618114 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123069833 14:105637337-105637359 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123089067 14:105734125-105734147 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123094851 14:105762282-105762304 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1124785743 15:32679080-32679102 AGGGCTCTGGAAGCTGGGCGTGG - Intronic
1125264286 15:37861826-37861848 AATGCTGCTGAAGCTGGACGTGG - Intergenic
1125571960 15:40726972-40726994 TAGGCTCCAGAAGCAGGACATGG - Intronic
1125825948 15:42676652-42676674 AAGGCTTCTGGATCTGGGAAGGG - Intronic
1126453445 15:48835247-48835269 AAAACTCCTGCACCTGGGCAAGG - Intronic
1127431546 15:58914903-58914925 AAAGCTCCTAGGGCTGGGCATGG + Intronic
1127466111 15:59246392-59246414 AATGATAGTGAAGCTGGGCATGG - Intronic
1127577184 15:60303292-60303314 AAGGATGCTGAAGTTGGGCATGG - Intergenic
1128170960 15:65512575-65512597 AAGGCACATGAAGCTGTTCACGG + Intronic
1128986107 15:72222707-72222729 AAGGCTCCTGGACCTGGGCATGG - Intronic
1129174845 15:73832564-73832586 CAGTCTCCTGAAGCAGGGCTAGG + Intergenic
1129310870 15:74708057-74708079 AAGACATCTGAGGCTGGGCATGG + Intergenic
1130014292 15:80175159-80175181 AAGGCTCCTGAGCTTTGGCAAGG + Intronic
1130627792 15:85533822-85533844 CAGGCACCTGAAGCTGCCCACGG + Exonic
1130913014 15:88283930-88283952 AAGGCAGGTGAAGCTGGGCAGGG - Intergenic
1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG + Intronic
1131711487 15:95060757-95060779 AAGAATGCTGAGGCTGGGCATGG + Intergenic
1132558218 16:582044-582066 AAGCCTCCTGCAGCCAGGCACGG - Intronic
1132699720 16:1217149-1217171 AAGGCTCCGGAAGCAGGGCCGGG - Intronic
1132774914 16:1588072-1588094 CAGGCTCCTGAAGCCGGGACAGG - Intronic
1133055743 16:3144663-3144685 CAGGATCCAGGAGCTGGGCAGGG + Intronic
1133765134 16:8832618-8832640 GAGGCTCCTGCAGCCGGCCAGGG - Intronic
1133822761 16:9251306-9251328 AAGGCTCTGGGAGGTGGGCAGGG + Intergenic
1133936882 16:10276535-10276557 AAGGCAGATGAGGCTGGGCACGG - Intergenic
1134093089 16:11401939-11401961 AAGGCTCCTCAGGCAGGGGAGGG + Intronic
1135399050 16:22153053-22153075 AATACACCTAAAGCTGGGCACGG + Intronic
1135521397 16:23181421-23181443 AAGGCAGCTGAAGCTAGGAAAGG + Intergenic
1135737084 16:24940400-24940422 AAGGCTGGAAAAGCTGGGCATGG + Intronic
1136086233 16:27887243-27887265 AAGGCTTCTAGGGCTGGGCATGG - Intronic
1136246413 16:28978761-28978783 AAGGCACCTGAAGCTAAGGACGG - Intronic
1136521372 16:30798397-30798419 ATGGCCCCTGGAGCTGAGCAGGG + Intergenic
1137009837 16:35311279-35311301 AAGGCTCTGGTAGATGGGCATGG - Intergenic
1137346705 16:47668548-47668570 AATGCTGCTGAAGCTGGCAAGGG - Intronic
1137587500 16:49672524-49672546 AAGCCTCCTGAGGCTGGGCATGG + Intronic
1138291874 16:55854820-55854842 AAGCCCTCTGAAACTGGGCATGG - Intronic
1138755756 16:59482496-59482518 AAAGCTACTGAGGCTGGACATGG - Intergenic
1139608569 16:68038318-68038340 CAGGCTCCTGGACCTTGGCAGGG - Intronic
1141195411 16:81856949-81856971 CAGCCTCCAGAAGCTGGGAAAGG + Intronic
1142432586 16:90037994-90038016 AAGGCATCTGAAGCTGGTCCAGG - Intronic
1142472021 17:170003-170025 AACGCACCTGGAGCTGGGAAGGG + Intronic
1142512839 17:408589-408611 ATGGCTGCAGAGGCTGGGCATGG - Intergenic
1142624223 17:1181568-1181590 CAGGCACCTGGAGCTTGGCAGGG + Intronic
1143811730 17:9477146-9477168 GAGGAACCTGAAGCTGGGCACGG - Intronic
1143918958 17:10315582-10315604 AAATCTGCTGCAGCTGGGCACGG - Intronic
1144395217 17:14836717-14836739 AAGCCTCCGGAAGCTGGGAAAGG + Intergenic
1144488020 17:15683886-15683908 AAGGCTCCTGTACCAGGGCCAGG - Intronic
1144530580 17:16034872-16034894 AAGTCTCCTATACCTGGGCAAGG - Exonic
1144537476 17:16104965-16104987 AAGGCTCCTGAAGTCGGGGTTGG + Intronic
1144585092 17:16482918-16482940 AAAGGTCCTGAAGCTCGGCTGGG + Intronic
1144703763 17:17354299-17354321 GAAGCTCCTGAAGCTCGGCGAGG - Intergenic
1144823384 17:18090960-18090982 ATGGGTTCTGCAGCTGGGCATGG - Intronic
1144912996 17:18698402-18698424 AAGGCTCCTGTACCAGGGCCAGG + Exonic
1145021634 17:19436132-19436154 AAGGCTCTTCAGGCTAGGCACGG + Intergenic
1145861092 17:28211123-28211145 AAGTCTGATGAGGCTGGGCATGG + Intergenic
1146019752 17:29267342-29267364 AAGGCACTAGCAGCTGGGCAGGG - Intronic
1146042747 17:29472541-29472563 AAGGCTATAGCAGCTGGGCATGG - Intronic
1147047375 17:37763425-37763447 AAGGAAACTGAGGCTGGGCATGG - Intergenic
1147158317 17:38556599-38556621 AAGGCTATGGGAGCTGGGCAGGG + Intronic
1147414078 17:40275855-40275877 AAGAATCTAGAAGCTGGGCATGG - Intronic
1147593854 17:41704013-41704035 AAAGCCACTGAAGCTGGGCTTGG + Intergenic
1148093643 17:45037748-45037770 AAAGCTCTTGAAGCTTGGCGTGG - Intronic
1149061484 17:52427960-52427982 AAGACACCTGCGGCTGGGCACGG + Intergenic
1149403711 17:56325605-56325627 AGGGCTGCTGAAGCTGTGCATGG - Intronic
1149414905 17:56449002-56449024 CCGGCTCCTGACGCAGGGCAAGG + Intronic
1149546936 17:57510760-57510782 AAGTCTGCTGGAGCTGGCCAAGG + Intronic
1150418210 17:65004957-65004979 AAGGTTGATGCAGCTGGGCATGG + Intergenic
1150659891 17:67066035-67066057 AACCCTCCTGAGGCTGGGCGCGG - Intergenic
1150793468 17:68219253-68219275 AAGGCTGATGCAGCTGGGCACGG - Intergenic
1151510967 17:74559747-74559769 AATGTACCTGAGGCTGGGCATGG - Intergenic
1151643667 17:75414892-75414914 AAGGCTATTGAGGCCGGGCACGG + Intergenic
1151713783 17:75821205-75821227 ACGCCACCAGAAGCTGGGCATGG - Intronic
1151901654 17:77019986-77020008 GAGGCCCCAGAGGCTGGGCATGG - Intergenic
1151903180 17:77031019-77031041 AAGCCTTCTGAAGCCAGGCATGG + Intergenic
1152300960 17:79495246-79495268 AAGCCTCCTGAAGGGGGGAAGGG + Intronic
1152845382 17:82596571-82596593 GAGGCTGCAGGAGCTGGGCAGGG - Intronic
1153224787 18:2891276-2891298 AAGGCTCCTGTAGCCGGGCTCGG - Exonic
1153229751 18:2924463-2924485 AAGGCACCTGTCGCTGTGCAGGG - Exonic
1154180936 18:12139352-12139374 AAGAATGTTGAAGCTGGGCACGG + Intergenic
1155060234 18:22222197-22222219 AAGAATAATGAAGCTGGGCATGG + Intergenic
1157343973 18:46806644-46806666 AAGAATTCTTAAGCTGGGCATGG - Intergenic
1158647886 18:59264138-59264160 AAGCCTCCAGGAGGTGGGCAGGG - Intergenic
1159687687 18:71443817-71443839 AAGGCTGCAGAAGCTGGGAAAGG - Intergenic
1160008939 18:75089159-75089181 CAGGCTCCTGAGGCTGAGCGAGG + Intergenic
1160139390 18:76307581-76307603 CAGCCTCTAGAAGCTGGGCAGGG - Intergenic
1161025471 19:2034820-2034842 CAGGCTCCTGGGGCAGGGCAGGG + Intronic
1161043920 19:2124332-2124354 AAGGCTCTAGAAGCTGGGCCTGG + Intronic
1161078196 19:2296765-2296787 CAGGGTCTTGCAGCTGGGCACGG - Intronic
1161109455 19:2461261-2461283 AAGAGTCTTGCAGCTGGGCACGG - Intergenic
1161803020 19:6426212-6426234 AAGATTCCTGAAGCTGGGGTTGG - Exonic
1161920508 19:7262178-7262200 AAGCCTCCTAAGGCTGGGCGCGG + Intronic
1162259461 19:9520753-9520775 AAGGCTTCCAGAGCTGGGCAGGG + Intergenic
1162327867 19:10009469-10009491 AAGGCTCCAGCAGCTGGGGTGGG + Intronic
1162551740 19:11361890-11361912 AGGGCTCCAGAAGAGGGGCAAGG - Intronic
1163361145 19:16847129-16847151 GAGGCCCCCGAGGCTGGGCAGGG - Intronic
1163521481 19:17794659-17794681 AAGATTCCTGAAGCTGGGGTCGG - Intergenic
1163822006 19:19501338-19501360 GCGGCTCCTGCAGCAGGGCACGG + Exonic
1164444558 19:28306324-28306346 AGGGCTTCTGTAGCTGGGCGTGG + Intergenic
1164816220 19:31205476-31205498 ATGGCTCCTGAAACTTGGGATGG + Intergenic
1165077278 19:33286873-33286895 GAGGCCCCAGAAGCTGGCCATGG + Intergenic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1165401633 19:35604503-35604525 CAGGCTTCTGAACCTGGGCCGGG - Intergenic
1165449046 19:35871778-35871800 AAGGTTCCTGAGGCAGGGGATGG + Intronic
1165602373 19:37065515-37065537 CAGCCTCTTGAAGCTGGGAATGG + Intronic
1165880726 19:39040998-39041020 AAGCCAGCTGGAGCTGGGCATGG - Intergenic
1166310675 19:41960677-41960699 AAGTCACTTGAACCTGGGCATGG - Intergenic
1166600011 19:44085030-44085052 AAGGCTCCTAGTGCTGGGAAAGG - Intronic
1166766114 19:45252612-45252634 AAGGCCTCTGAAGCTGAGGAGGG - Intronic
1166845687 19:45726793-45726815 AAAGGTACTGAGGCTGGGCAAGG - Intronic
1167012675 19:46819222-46819244 CAGCTTCCTGAAGCTGGACAGGG + Intergenic
1168007173 19:53499836-53499858 AAGTCAAATGAAGCTGGGCATGG + Intergenic
1168689324 19:58367325-58367347 AAGGCTCCTGAAGCTGCCTAAGG + Intergenic
925162802 2:1697827-1697849 AAGGGTCCTGCAGCTGCGGAGGG - Intronic
926048154 2:9725238-9725260 ACGGCTCCTGCAGCAAGGCAGGG + Intergenic
926198430 2:10777188-10777210 AAGGCATCTGTGGCTGGGCATGG + Intronic
926279181 2:11430943-11430965 AAGGCTTCTGAAGATGCCCAAGG - Intergenic
927554841 2:24024169-24024191 AAGGATCATGCAGGTGGGCACGG - Exonic
927796894 2:26057271-26057293 AAAGCTAAGGAAGCTGGGCATGG + Intronic
928118370 2:28564254-28564276 AAGGTGAATGAAGCTGGGCAAGG + Intronic
930138327 2:47925280-47925302 AAAACTACTGAAGCTGGGCCGGG + Intergenic
931264287 2:60646704-60646726 AGGGCCCCTGAAGATGTGCAGGG - Intergenic
932081333 2:68718299-68718321 AAGCCTCTAGAAGCTGGGAAAGG - Intronic
932242490 2:70168270-70168292 AAGGATCCTATAGCTGGGCATGG - Intronic
933767884 2:85722909-85722931 ATGGCTTCTGAGGCAGGGCAGGG + Intergenic
933776824 2:85776154-85776176 CAGGCTCAAGCAGCTGGGCAGGG + Intronic
934095129 2:88594901-88594923 AAAGAACCTGAGGCTGGGCATGG + Intronic
934709030 2:96503295-96503317 AAGGCTCCTGAAGCAGGGATCGG - Intronic
936464538 2:112735332-112735354 ACTGTTCCTGAGGCTGGGCATGG - Intronic
937330813 2:121027430-121027452 GGGGCTCCAGAAGCTGGGAAAGG + Intergenic
937882225 2:126877005-126877027 AAGGCTCAGGAAGCTGCTCAGGG - Intergenic
938388710 2:130887173-130887195 AAGCCTGCTGGAGCTGGGCATGG + Intronic
938885854 2:135647048-135647070 AAGACTCCTAATACTGGGCAAGG + Intronic
940496637 2:154437564-154437586 AACCCTCATGAGGCTGGGCATGG + Intronic
940952551 2:159692558-159692580 AAGTCTGCAGAATCTGGGCATGG + Intergenic
941465516 2:165821718-165821740 AAGACACCTGGGGCTGGGCATGG + Intergenic
942237516 2:173926506-173926528 AACGCACCAGAGGCTGGGCACGG + Intronic
942292619 2:174487191-174487213 AAGGCTCCTGGAAATGGGCGGGG - Intergenic
944666175 2:201961409-201961431 AGGGATCGTGAAGCTAGGCAGGG - Intergenic
947199230 2:227599786-227599808 CAACCTCCTGAAGCTGGCCATGG + Intergenic
948163624 2:235844594-235844616 GAAGCTCCTGCAGCTTGGCACGG + Intronic
948427216 2:237895639-237895661 AAGGCTCGTGAAGCCCGGCAGGG + Intronic
948644063 2:239392847-239392869 AAGGCCCCTGCAGATGGGCCAGG + Intronic
948703298 2:239774233-239774255 AAGGCTCCTGCAGCAGAGCTGGG + Intronic
1168956177 20:1835998-1836020 CAGGGTCCAGAAGCTGGCCAAGG + Intergenic
1169140450 20:3224603-3224625 GAGGCTCAGGAGGCTGGGCAGGG - Intergenic
1169340625 20:4793768-4793790 AAGGATCCTGAGGCTGTGCGTGG - Intronic
1170536242 20:17343820-17343842 AAGCCTCCAGAAGCTGGAAAAGG + Intronic
1170819073 20:19740523-19740545 AAGGCACCTGATGCTGGTCCAGG - Intergenic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1171424185 20:25039268-25039290 AAGGCCCCTGGAGCTGGGCCTGG - Intronic
1172692191 20:36797561-36797583 CAGCCTTCTGCAGCTGGGCAAGG + Exonic
1173001596 20:39109610-39109632 GAGGCTCCCCAAGCTGGGGAGGG - Intergenic
1173001637 20:39109708-39109730 GAGGCTCCCGCAGCTGGGGAGGG - Intergenic
1173399293 20:42710382-42710404 CAGTGTCCTGAGGCTGGGCAGGG - Intronic
1173599634 20:44284383-44284405 AAGGCAAATGAGGCTGGGCATGG + Intergenic
1173610267 20:44362115-44362137 AAGCATGCTGAGGCTGGGCATGG + Intronic
1173795577 20:45857281-45857303 CAGGCCCCAGAAGATGGGCAGGG - Exonic
1173932216 20:46830260-46830282 AAGACTTCTTAGGCTGGGCACGG - Intergenic
1173965904 20:47112811-47112833 GAGGCTCCAGAAGCAGGGAATGG + Intronic
1174748210 20:53085658-53085680 AAGGCCCCTGAAAGAGGGCAAGG + Intronic
1175603702 20:60295651-60295673 AAGGCTACTGAGGCAGGGGAGGG + Intergenic
1175643216 20:60649124-60649146 AGGCCTCCAGAAGCTGGGAAAGG - Intergenic
1175788257 20:61725344-61725366 TAGGCACCTGCAGCTGGGAAGGG + Intronic
1176867288 21:14060545-14060567 TAGCCTCCAGCAGCTGGGCAGGG + Intergenic
1177631784 21:23738269-23738291 ATGACTCCTGAAGAAGGGCATGG - Intergenic
1178037708 21:28603184-28603206 AAGGCTGAAGAAGCAGGGCAGGG - Intergenic
1179382221 21:40910395-40910417 AATGGTTCTGAAGCTGGCCATGG - Intergenic
1181467897 22:23120106-23120128 AAGGCAGCTGGAGGTGGGCACGG - Intronic
1181861687 22:25823886-25823908 AAGGCTGCTGAAACCTGGCAGGG + Intronic
1182167227 22:28188386-28188408 CAGGGTCCTGCAGCTGGGCTTGG - Intronic
1182179475 22:28331181-28331203 AAGGCTCCTGAAGCTGATAAAGG + Intronic
1182306416 22:29372130-29372152 AAGGGAACTGAGGCTGGGCATGG + Intronic
1182442089 22:30370592-30370614 AAGCCTGCAGAAGGTGGGCAAGG + Exonic
1182478062 22:30587491-30587513 ATGCCTCCTGAAGCTGGCCACGG + Intronic
1182658644 22:31909440-31909462 AAGACACATGTAGCTGGGCACGG + Intergenic
1182664856 22:31950452-31950474 AAGGCTTCAGAAGCTGTGCCAGG - Intronic
1182991043 22:34768050-34768072 AAGGCTCTTGATGTAGGGCAGGG + Intergenic
1183253230 22:36744691-36744713 AGGGCTTCTGAAGTGGGGCAAGG - Intergenic
1184976896 22:48068698-48068720 AAGCCACCAGATGCTGGGCAGGG - Intergenic
1185169920 22:49286792-49286814 AAGGCTCCGGAAGCTTGGCCCGG - Intergenic
949977369 3:9473323-9473345 AAGTCTGCAGGAGCTGGGCAAGG + Exonic
950584464 3:13882440-13882462 AGGGCTCAGGAAGTTGGGCAGGG - Intergenic
950927677 3:16759308-16759330 AAGCCTCCTGGAGCTGGGAGTGG + Intergenic
951713715 3:25613885-25613907 AAGGATCCTGAAGCTTGGAGAGG - Intronic
951814788 3:26742053-26742075 CAGCCTCTTGAAGCTGGGTAAGG + Intergenic
952261040 3:31740610-31740632 AATGCTTATGAAGCTGGGTATGG + Intronic
953128160 3:40111580-40111602 AAGGATGCTGAAGGTGGCCAGGG + Intronic
953558129 3:43963091-43963113 AAGCCTCCTGCAGCCAGGCACGG + Intergenic
954383939 3:50234717-50234739 AAGGCCCCTGAAGCAAGACAGGG - Intronic
954430867 3:50470300-50470322 CAGGCTGCTGAGGCTGGGCCAGG - Intronic
954791354 3:53135707-53135729 AAGCCCCCAGAGGCTGGGCATGG - Intergenic
955950128 3:64235525-64235547 AAAGCTCCAGAAGGGGGGCAGGG - Intronic
956685718 3:71825579-71825601 TAGGCTCCTGCTGCTGGTCATGG - Intergenic
957915940 3:86687588-86687610 AAGTCACCTAAAGCTGGGGATGG - Intergenic
957969260 3:87362228-87362250 AAGGTTCATGAAGATGGACAGGG + Intergenic
958862152 3:99457466-99457488 GAGCCACCTAAAGCTGGGCATGG + Intergenic
958908368 3:99966222-99966244 CAGGCTGCAGAGGCTGGGCATGG + Intronic
960275570 3:115725673-115725695 CAGGCTTCTGAGGCTTGGCATGG - Intergenic
960394552 3:117120199-117120221 CAGGCTTCTGCAACTGGGCAGGG + Intronic
961162348 3:124739622-124739644 ATTCCTCTTGAAGCTGGGCATGG - Intronic
961305771 3:125958587-125958609 CAGGGTGCTGAAGCTGGGTATGG - Intergenic
961816095 3:129551158-129551180 AAGGCCCCTAAAGCTGGGCAGGG + Exonic
962494982 3:135930242-135930264 AATCATCCTGAATCTGGGCAGGG - Intergenic
962556256 3:136555219-136555241 AAAACACCAGAAGCTGGGCATGG + Intronic
962914884 3:139892114-139892136 TAGACTCCTGCAGCTGGGAATGG + Intergenic
963140270 3:141941139-141941161 GAGGCTCAAGAAGCTGGGCATGG + Intergenic
963898284 3:150709316-150709338 AATGTTCCTAAAGCTGGGCGCGG + Intergenic
964804180 3:160588319-160588341 AAGCCTCCTGGAGCTGGGGGTGG - Intergenic
964855261 3:161139470-161139492 AAGGCTCCTTAAGCAAGCCAGGG + Intronic
964870290 3:161306352-161306374 AATGCTCATGAGGCTGGGCGCGG + Intergenic
965857268 3:173103604-173103626 AAGTGTCCTGAGGCTGTGCAGGG + Intronic
967037821 3:185661344-185661366 AAGGCATTTGAGGCTGGGCACGG + Intronic
967882299 3:194310348-194310370 AAGCTCCCGGAAGCTGGGCATGG + Intergenic
968255198 3:197263494-197263516 ATGTCTCATGAGGCTGGGCATGG + Intronic
968534873 4:1118321-1118343 AAGGCACTTGCGGCTGGGCATGG + Intergenic
968727003 4:2252419-2252441 GAGCCTCCTGAAGCGGGCCAAGG - Exonic
969069784 4:4526677-4526699 AAGACTTCTGAAGCCAGGCATGG + Intronic
969608843 4:8216062-8216084 AGGGCTCCAGAAGAGGGGCAGGG - Intronic
969659961 4:8521344-8521366 AAGCCTGCTGATGCTGCGCATGG - Intergenic
970107718 4:12603715-12603737 GAGTCTCCTGAAGCTAGGGATGG + Intergenic
970826271 4:20280041-20280063 AAGGCTTTTACAGCTGGGCATGG + Intronic
971209191 4:24599584-24599606 AAGGCTCCTCAAGCACGGCCAGG + Intergenic
971494138 4:27246324-27246346 AAGGATCTTAAGGCTGGGCATGG + Intergenic
972731333 4:41798217-41798239 AAAGGTCTTGAAGCTGGGCATGG + Intergenic
974039691 4:56846801-56846823 AAGGCTACTGAAGTTAGGCTGGG + Intergenic
974108323 4:57496725-57496747 AAGACTCCTGAAGATAAGCAGGG - Intergenic
974544566 4:63284104-63284126 TAGCCTCCGGAAGCTGGGAAAGG - Intergenic
974893144 4:67906703-67906725 AAGACACCTGAAACTGGGGATGG + Intergenic
974895100 4:67928334-67928356 GAGTCACCTGAGGCTGGGCATGG - Intronic
975557163 4:75676127-75676149 AAGGGGCCTGAACCTGGGCAGGG - Intronic
979938136 4:126723073-126723095 AAGGTTACTAAAGGTGGGCAGGG + Intergenic
981099153 4:140811605-140811627 AAGGCTCCCGAAGCTGCTGAGGG + Intergenic
982091778 4:151885732-151885754 AAGTCTCTTGAGGCTTGGCATGG - Intergenic
982125325 4:152179129-152179151 CAGACCCCTGGAGCTGGGCAAGG + Intergenic
984219028 4:176950681-176950703 AAGGCTGTAGAAGCAGGGCATGG + Intergenic
984286413 4:177735462-177735484 AAGACACCTGAAGTTGGCCATGG + Intronic
985768871 5:1796599-1796621 GAGGGGCCTGAGGCTGGGCACGG - Intergenic
986134759 5:4966017-4966039 AAGGCTCATGGGGCTGGGCACGG + Intergenic
986747289 5:10755737-10755759 AAAACTTCTGAAGCTGGGAAGGG + Intronic
987751827 5:22049367-22049389 AAAGCTGCTAAACCTGGGCAAGG - Intronic
987751832 5:22049426-22049448 AAAGCTGCTGAACTTGGGCAAGG - Intronic
987751836 5:22049485-22049507 AAGGCTGCTGAACTTAGGCAAGG - Intronic
990248478 5:53888572-53888594 AATCCTCTTAAAGCTGGGCATGG - Intronic
990372447 5:55134470-55134492 AAAACTCCTGGGGCTGGGCACGG + Intronic
990977032 5:61569395-61569417 AAGGCGCCTGGCTCTGGGCAGGG - Intergenic
991018453 5:61956396-61956418 AAGCCACCTGAAGCTGGGGGTGG + Intergenic
992000646 5:72432672-72432694 AAGCCACCTGGAGCTGGGGAGGG + Intergenic
992035255 5:72767667-72767689 AAGGCTGCTGGACCTGGACATGG + Intergenic
992402079 5:76420663-76420685 AAAGTTCCAGAGGCTGGGCACGG - Intronic
992653530 5:78885639-78885661 AACACTCGTGAAGCTGGCCAGGG - Exonic
995182220 5:109239692-109239714 AAGGCTCCTGAGGCTATGGAGGG + Intergenic
995751075 5:115453806-115453828 AGGTGTCCTGAGGCTGGGCAGGG - Intergenic
996198761 5:120643712-120643734 AATGCTCTTTAGGCTGGGCATGG + Intronic
996531568 5:124532865-124532887 GGGGCTCCTGGAGCTGGGAAGGG + Intergenic
996731907 5:126724921-126724943 AAGGGGCCTGGAGCTGGGAATGG + Intergenic
997172538 5:131738152-131738174 AACTATACTGAAGCTGGGCATGG - Intronic
998106173 5:139470854-139470876 CAGGCTCCTGAAGCTGGCAGGGG + Intergenic
998214106 5:140224427-140224449 AAGTCTGCGGCAGCTGGGCATGG - Intronic
998883705 5:146672060-146672082 CAGGCTGCTGGAGCTTGGCAGGG + Intronic
999280893 5:150365008-150365030 CAGACTCAGGAAGCTGGGCATGG - Intronic
999562375 5:152818553-152818575 ATGGCTCCTGAAGGCAGGCAGGG + Intergenic
1000081725 5:157854851-157854873 AGGGCCACTGAGGCTGGGCAAGG + Intronic
1001749440 5:174117721-174117743 AAACCACCAGAAGCTGGGCAGGG + Intronic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1001909936 5:175507680-175507702 GAGTCTTCTGAGGCTGGGCATGG + Intronic
1001916426 5:175564461-175564483 AAAACACTTGAAGCTGGGCATGG - Intergenic
1002086807 5:176781006-176781028 AGGGCTCTTGGAGCTGGGAAAGG + Intergenic
1002102985 5:176866504-176866526 GAGGCTCCTGAAGGAGGGCCGGG + Intronic
1002650719 5:180691155-180691177 AAGCCTCCTGAAACTGAGCTGGG + Intergenic
1002930796 6:1633707-1633729 AAGGCTGCTGTGACTGGGCATGG + Intronic
1003115062 6:3278095-3278117 ATGGCTCCAGAGTCTGGGCACGG - Intronic
1003858612 6:10300868-10300890 AAGGGTTGTGAGGCTGGGCACGG - Intergenic
1004802376 6:19163916-19163938 AAGGCCCCTTGAGCTGGGGATGG - Intergenic
1005387470 6:25299683-25299705 ATGTCTCCAGAGGCTGGGCACGG + Intronic
1007252571 6:40505880-40505902 AAGGCACGTGGAGATGGGCAGGG + Intronic
1007709080 6:43810290-43810312 AGGGCTCCTGGGGCTGGGCTGGG + Intergenic
1008099211 6:47373109-47373131 AAGGCAAAAGAAGCTGGGCATGG + Intergenic
1008288314 6:49681816-49681838 AAAAATCTTGAAGCTGGGCATGG - Intergenic
1008709492 6:54207535-54207557 AAGGCAGCTGAAGAGGGGCATGG - Intronic
1010289302 6:74116677-74116699 AAGGATCCTGAAGCTGAGGGAGG - Intergenic
1010785366 6:79993993-79994015 CAGTATCCTGAAGCTGAGCAGGG - Intergenic
1010980551 6:82364892-82364914 AAGGCTCGGGAGGCTGGGCCCGG - Exonic
1011095546 6:83658067-83658089 AAGAATCTTGAGGCTGGGCATGG - Intronic
1011601492 6:89064474-89064496 AAAACTCCTCTAGCTGGGCATGG - Intergenic
1012355068 6:98304168-98304190 AAGGCTCCTGGAACTGGTAAAGG - Intergenic
1014830963 6:126102297-126102319 AATTCGCCTGAAGCTGGACAGGG + Intergenic
1015004797 6:128266232-128266254 AAAGGTCCTGAGGCTGGGAAAGG + Intronic
1015088805 6:129329650-129329672 ATGGCGACTGCAGCTGGGCATGG - Intronic
1015274606 6:131371288-131371310 AAGGCACCAGAAGCTGAGAAAGG + Intergenic
1017073580 6:150598526-150598548 TGAGCTCCAGAAGCTGGGCAGGG + Intergenic
1017468608 6:154717926-154717948 AATGCTCCAGAAGCTGAGAAAGG + Intergenic
1017906572 6:158760857-158760879 AGAGCTGCTGGAGCTGGGCACGG - Intronic
1017978820 6:159380697-159380719 AAGCCTACCAAAGCTGGGCAGGG + Intergenic
1018461343 6:164002225-164002247 AAGGATCCTGAAGGAGGGTAGGG + Intergenic
1019009734 6:168834398-168834420 AGGACTCCTGCAGCTGGGCAGGG - Intergenic
1019294339 7:266102-266124 CAGGCTTCTGCAGCTGGGCTGGG - Intergenic
1019446807 7:1075565-1075587 AGGGCTCTTGAAGCTGACCAAGG + Intronic
1019615528 7:1957932-1957954 CAGGCTCCTCCAGCTGAGCAGGG - Intronic
1019973262 7:4559309-4559331 AATGCCCATGAAGCTGGGCGTGG + Intergenic
1020078750 7:5275329-5275351 ACAGCTCCTGGAGCTGGGCCAGG + Intronic
1020183978 7:5944666-5944688 AAGACTGCTGAGGCTGGGCATGG + Intronic
1020298940 7:6780111-6780133 AAGACTGCTGAGGCTGGGCATGG - Intronic
1020516681 7:9130279-9130301 TGGCCTCCTGAAGCTGGGAAAGG - Intergenic
1021271018 7:18585495-18585517 TATGCTCCTGAAGCTGAGCCTGG - Exonic
1021787525 7:24166142-24166164 GAGGCTCCTTAACCTTGGCAGGG + Intergenic
1021930609 7:25577705-25577727 ACTGCTCCTGCAGCTGAGCAGGG - Intergenic
1022141999 7:27500721-27500743 AATGCACTTGAGGCTGGGCATGG + Intergenic
1023562445 7:41490152-41490174 AAGGCTCCCTAAGCTGTGCCAGG - Intergenic
1024053392 7:45644341-45644363 ACGGGTCCTGGGGCTGGGCAGGG + Intronic
1024506770 7:50168468-50168490 ATGGCTCCTGGGGCTAGGCAGGG - Intergenic
1025200145 7:56956856-56956878 ACAGCTCCTGGAGCTGGGCCAGG - Intergenic
1025671799 7:63620076-63620098 ACAGCTCCTGGAGCTGGGCCAGG + Intergenic
1026571988 7:71539222-71539244 GAGTATCCTGAGGCTGGGCACGG - Intronic
1026792376 7:73342622-73342644 AAGGCTCCCACAGCTGGCCAAGG - Intronic
1026950157 7:74341467-74341489 AACTTTCCTGAGGCTGGGCACGG - Intronic
1028386340 7:90258410-90258432 AAGCCTCCAGAAGCTGGGGAAGG - Intronic
1028400383 7:90419131-90419153 AATGCAACTGAGGCTGGGCACGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029424559 7:100487850-100487872 AAGGAACCTACAGCTGGGCATGG + Intronic
1029994333 7:104992127-104992149 AAGCCTTCTCAGGCTGGGCACGG + Intergenic
1030307620 7:108035096-108035118 AAGGCTCCTGAAGGTTAGAAAGG - Intronic
1030709990 7:112738712-112738734 AAGGGTCTTGCAGCTGGGCATGG - Intergenic
1032223150 7:130009288-130009310 AATGCTTCTAAAGCTGGGCTTGG + Intergenic
1032397071 7:131598119-131598141 AAAGCCCCTTTAGCTGGGCATGG - Intergenic
1033155464 7:138953063-138953085 AAAGCAGCTGTAGCTGGGCACGG + Intronic
1033213989 7:139481032-139481054 AAGGCTCCTGAAGCTGGGCACGG - Intronic
1034147956 7:148888885-148888907 AAGGATCCTGAAGCGGAGCCGGG + Intergenic
1034158654 7:148976221-148976243 GGATCTCCTGAAGCTGGGCAGGG + Intergenic
1034530041 7:151689866-151689888 AGAGCTCCTGGAGCTGGGAACGG - Intronic
1034630120 7:152524213-152524235 AAAGCTCCGGAACCTGGGCCTGG + Intergenic
1034875887 7:154724530-154724552 AAGTCTCCTGAAGATGAGTATGG - Intronic
1035002240 7:155622321-155622343 AAGACATTTGAAGCTGGGCAGGG + Intronic
1037031210 8:14107931-14107953 AGGGATCCTGAGGCCGGGCACGG - Intronic
1037920691 8:22803375-22803397 AAGGCACCTCTGGCTGGGCACGG + Intronic
1038216243 8:25564235-25564257 AAGGTTTCAGCAGCTGGGCATGG - Intergenic
1038445415 8:27600512-27600534 AAGGCTTCTCAGGCTGGGCGTGG - Intronic
1038947301 8:32375266-32375288 AATGCTGATGAGGCTGGGCACGG - Intronic
1039646555 8:39290518-39290540 ATGGGTGCTGAGGCTGGGCAGGG + Intergenic
1040598767 8:48864270-48864292 AATGCACCTGGGGCTGGGCAAGG + Intergenic
1041312265 8:56529376-56529398 AATGATACTGAAGCTGGGAAGGG + Intergenic
1042726763 8:71887789-71887811 AAGACACCTAAAGCTGGGGATGG + Intronic
1043769869 8:84184599-84184621 AACGATCCTGAAGCAGGGAACGG - Intronic
1044573120 8:93741380-93741402 AAAGCTCCTGTGGCCGGGCACGG + Intergenic
1045315276 8:101038635-101038657 ATGACACCTGAGGCTGGGCACGG - Intergenic
1047608746 8:126500084-126500106 ATGGTCCCTGAAGCTGTGCAGGG - Intergenic
1048529790 8:135236844-135236866 AGGGGACCTGAAGCTGGGTAGGG + Intergenic
1048860884 8:138723932-138723954 AAGGCTCCTGATGCTGGAGGAGG - Intronic
1048861118 8:138724984-138725006 AAGTGTCCTGAAAGTGGGCATGG - Intronic
1049373953 8:142280330-142280352 AAGGCACCAGAGGCTGAGCAGGG + Intronic
1049469186 8:142767803-142767825 AGGGCCTCTGAGGCTGGGCAGGG + Intronic
1049806344 8:144542394-144542416 AAGGCTCCTGAGGCTGAGGCAGG + Intronic
1050070307 9:1804309-1804331 AAGTCCCTAGAAGCTGGGCATGG + Intergenic
1051220466 9:14843308-14843330 AAGGCTTGAGAAGATGGGCAAGG - Intronic
1051524835 9:18031894-18031916 AAGGCACATGATCCTGGGCAGGG + Intergenic
1051783124 9:20712367-20712389 AAAGTTGCTCAAGCTGGGCATGG + Intronic
1054762275 9:69013936-69013958 ACGGCTCAGGACGCTGGGCATGG - Exonic
1054927811 9:70605498-70605520 AATGCTCCTGAAGATGGGGAGGG - Intronic
1056264545 9:84883249-84883271 AAGGACCATGAAGCTGGGTAAGG + Intronic
1056683283 9:88738670-88738692 AACTCTCCTGTAGCAGGGCATGG + Intergenic
1057262249 9:93591652-93591674 AAGACTCCAGACCCTGGGCAGGG + Intronic
1057880948 9:98792223-98792245 ATGACTCCTGAAGCAGGACACGG - Intronic
1057892102 9:98877158-98877180 GAGGCTCCTGCAGCTGAGAATGG - Intergenic
1057897543 9:98921893-98921915 AAGGCTCCTTTCACTGGGCAGGG - Intergenic
1058684368 9:107467164-107467186 ATGGCTCCTGAAGCTGCTGATGG + Intergenic
1059185965 9:112271115-112271137 AAGGAACCTAAAGCTGAGCATGG - Intronic
1060151969 9:121294538-121294560 CTGGCTCCGGAAGCTGGGAAAGG + Intronic
1060485259 9:124042361-124042383 CCGGCTCCTGGAGCAGGGCAGGG - Intergenic
1060920527 9:127417590-127417612 AAAGCACCTGAACCTGGGGACGG + Intergenic
1061130920 9:128707224-128707246 AGGACTCCTGTAGCTGGGCCTGG - Exonic
1061169466 9:128943877-128943899 AAGATTCCTGAGGCTGGACAAGG - Intronic
1061538912 9:131266803-131266825 ATGGTGCCTGAAGCTGGGCCAGG - Intronic
1061557455 9:131380279-131380301 AAGAGTTCTTAAGCTGGGCACGG + Intergenic
1061669923 9:132182901-132182923 GAGGCTGCTGAAGCTGGTCTGGG - Intronic
1061718320 9:132535419-132535441 AAGTCACTTGAAGCTGGGCGAGG + Intronic
1061822819 9:133238262-133238284 AAGGCCCCCAGAGCTGGGCAGGG + Intergenic
1061841031 9:133358697-133358719 GAGGCACCTGAAGCTTGGCAGGG + Intronic
1061945378 9:133905742-133905764 GAGGCTCCTATAGCTGGGCGAGG + Intronic
1061999650 9:134209571-134209593 AGAGCTCCTGAGGCTGGGCTGGG + Intergenic
1062454610 9:136629651-136629673 AAGGCCCCTGAGCCTGGGCCCGG + Intergenic
1062681674 9:137785328-137785350 ATGGCCCCAGGAGCTGGGCAAGG + Intronic
1185755875 X:2652482-2652504 AAGGCTGATAAGGCTGGGCACGG + Intergenic
1186083411 X:5958598-5958620 AAAGCTCCTGAAGTTGGTAATGG + Intronic
1186553813 X:10535930-10535952 AAGTATTCTGAGGCTGGGCATGG + Intronic
1187405690 X:19001607-19001629 AACGCTCCAGATACTGGGCACGG - Intronic
1188939081 X:36215407-36215429 AAGGAGCCTGAAACTGAGCATGG + Intergenic
1189070453 X:37857544-37857566 CAGTGTCCTGAAGCTGTGCAGGG + Intronic
1189268860 X:39736392-39736414 TTGGCTCCTGAAGGTGGGCCCGG - Intergenic
1189514205 X:41694946-41694968 AGTGGTTCTGAAGCTGGGCAGGG + Intronic
1190735306 X:53251767-53251789 AAGACTGCAGAGGCTGGGCATGG + Intronic
1191676150 X:63794498-63794520 ATGCCTGCAGAAGCTGGGCAGGG - Intergenic
1192504324 X:71671715-71671737 AATGCTCCTGTGGCAGGGCAGGG - Intergenic
1192625709 X:72725743-72725765 AAGAACCCTGAGGCTGGGCACGG - Intergenic
1192862143 X:75086135-75086157 TAAGTTCCTGAGGCTGGGCATGG - Intronic
1192908442 X:75578196-75578218 AAGCCACCTAAAGCTGGGAATGG + Intergenic
1194481663 X:94433817-94433839 AAGGTCCTTGAGGCTGGGCACGG - Intergenic
1195898145 X:109769597-109769619 AACGGTGCTGCAGCTGGGCATGG + Intergenic
1198316019 X:135467224-135467246 ATGGTTCCTGAGGCTGGGAAGGG + Intergenic
1198330909 X:135621621-135621643 GAGGCTCCTGGGTCTGGGCAAGG + Intergenic
1198336017 X:135667374-135667396 GAGGCTCCTGGGTCTGGGCAAGG - Intergenic
1198363514 X:135918353-135918375 GAGGCTCCTGGGTCTGGGCACGG + Intergenic
1198589523 X:138161781-138161803 AAGGATTCTTAGGCTGGGCATGG + Intergenic
1199247787 X:145626262-145626284 GAGCCACCTGAAGCTGAGCATGG - Intergenic
1199721808 X:150547689-150547711 CAGGCTCCAGTAGCGGGGCAGGG + Intergenic
1200098272 X:153674172-153674194 CAGGGTCCTGGAGCTAGGCATGG - Exonic
1201244189 Y:11986877-11986899 ACCCCTCCTGCAGCTGGGCAGGG + Intergenic