ID: 1033213990

View in Genome Browser
Species Human (GRCh38)
Location 7:139481037-139481059
Sequence CATATAAGGCTCCTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033213990_1033213998 20 Left 1033213990 7:139481037-139481059 CCCAGCTTCAGGAGCCTTATATG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 1033213998 7:139481080-139481102 TGAGCATCAGAAGTGGCAGCAGG No data
1033213990_1033213999 23 Left 1033213990 7:139481037-139481059 CCCAGCTTCAGGAGCCTTATATG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 1033213999 7:139481083-139481105 GCATCAGAAGTGGCAGCAGGAGG No data
1033213990_1033213996 -3 Left 1033213990 7:139481037-139481059 CCCAGCTTCAGGAGCCTTATATG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 1033213996 7:139481057-139481079 ATGTGGAAGAGGAAGACAGGTGG 0: 1
1: 0
2: 11
3: 92
4: 799
1033213990_1033213995 -6 Left 1033213990 7:139481037-139481059 CCCAGCTTCAGGAGCCTTATATG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 1033213995 7:139481054-139481076 TATATGTGGAAGAGGAAGACAGG No data
1033213990_1033213997 13 Left 1033213990 7:139481037-139481059 CCCAGCTTCAGGAGCCTTATATG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 1033213997 7:139481073-139481095 CAGGTGGTGAGCATCAGAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033213990 Original CRISPR CATATAAGGCTCCTGAAGCT GGG (reversed) Intronic
902602418 1:17549316-17549338 CATATAAGACTCACGAGGCTGGG - Intronic
904516450 1:31059390-31059412 CAAATCAGGCTCTTGCAGCTGGG - Exonic
904751846 1:32745645-32745667 CAGATAAGGATACTGAGGCTTGG - Intronic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
907227641 1:52963741-52963763 CATATGAGGAACCTGAAGCTTGG + Intronic
907280575 1:53344425-53344447 TAGATGAGGCTGCTGAAGCTGGG - Intergenic
907459614 1:54597512-54597534 CATTCAAGGCTTCAGAAGCTTGG + Intronic
911102671 1:94106564-94106586 CATATAAGGTTCCTCAAACTTGG + Intronic
918517189 1:185375995-185376017 CATACAGGGCTTCTCAAGCTTGG + Intergenic
921356797 1:214292218-214292240 CAGATATGGCTCCTGAGGCTTGG - Intronic
923468956 1:234273275-234273297 CCTATAAGTCTTCAGAAGCTTGG + Intronic
923558213 1:235018518-235018540 GCTGTATGGCTCCTGAAGCTGGG - Intergenic
923933643 1:238733878-238733900 CAAATAAGGAACCTGAAGCGTGG - Intergenic
1063870013 10:10406756-10406778 CAAATTAGGCTCCTTAAGATAGG - Intergenic
1068921574 10:62489943-62489965 CATGTAAGGCCCCTGAGACTAGG + Intronic
1069139876 10:64810006-64810028 CATTTAAGTCTGCTGGAGCTGGG + Intergenic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1072365305 10:94703307-94703329 CGTTTAAGTCTGCTGAAGCTGGG + Intronic
1072596371 10:96876174-96876196 CAGATATGGCTCCTCAACCTTGG - Intronic
1077472869 11:2772428-2772450 CATCTCAGGCTCCTGAAGTCAGG + Intronic
1078006378 11:7535527-7535549 CAGATAAGGAAACTGAAGCTTGG - Intronic
1078015812 11:7613523-7613545 CATATGAGGGTACTGAAGATTGG + Intronic
1078109024 11:8376982-8377004 CAGATTATGCTTCTGAAGCTGGG - Intergenic
1079496529 11:21050961-21050983 TATATGAGGCTCCTGACCCTGGG - Intronic
1080033552 11:27687981-27688003 CATTTAAGTCTGCTGAAGCTGGG + Intronic
1080611039 11:33904109-33904131 CCTATAAGGCTGCTGGAGCTTGG + Intergenic
1080697432 11:34614967-34614989 CTTATCAGGCTCATGAGGCTCGG + Intergenic
1081382003 11:42428148-42428170 GATATAAGCCTTCTGAAGGTAGG + Intergenic
1083275133 11:61592674-61592696 CTTAAAAGGCTCCTGAGGGTGGG - Intergenic
1092581626 12:9849160-9849182 CGTTTAAGTCTGCTGAAGCTTGG + Intergenic
1093402347 12:18761488-18761510 CATTTAAGTCTGCTGAAGCTGGG - Intergenic
1093655262 12:21687518-21687540 CATAAGAGTCTCCTGAAGCTAGG - Intronic
1094737638 12:33253218-33253240 CATACAATGTGCCTGAAGCTGGG - Intergenic
1098414624 12:70218990-70219012 AATTACAGGCTCCTGAAGCTAGG + Intergenic
1101043650 12:100782646-100782668 CAGATAAGGAAACTGAAGCTGGG - Intronic
1102515924 12:113446603-113446625 AATGTAAGCCTCCTGAAGCCAGG - Intergenic
1103744214 12:123111243-123111265 CATACAAGCCTCCTGACCCTGGG + Intronic
1106814202 13:33388800-33388822 CATATAAGGCTACTGAGATTAGG - Intergenic
1107100580 13:36586551-36586573 CATTTACAGCTCCTTAAGCTGGG + Intergenic
1108690799 13:52857586-52857608 TATACAAGGCTCCTGAGGCGAGG - Intergenic
1112946386 13:104932036-104932058 GATATAAGATTCCTGAAACTTGG + Intergenic
1114318687 14:21528650-21528672 CAGATAAGGAAACTGAAGCTTGG + Intronic
1114559355 14:23579132-23579154 GAAATAAGGCTCCTGAAGGGAGG + Intergenic
1118770312 14:68938450-68938472 CAGATAGGGATCCTGAGGCTAGG - Intronic
1119436729 14:74602235-74602257 CAGATAAGGAAGCTGAAGCTCGG - Intronic
1120509874 14:85400196-85400218 CATATAAGGCTTCAGAATTTGGG - Intergenic
1125156645 15:36594387-36594409 CATATAACTCTTCTGAAGCATGG + Intronic
1125389420 15:39175193-39175215 CATATAAGGCTAGTGAGGGTTGG + Intergenic
1126697555 15:51339139-51339161 AATAGAAGCCTCCTGAGGCTAGG - Intergenic
1127394654 15:58534755-58534777 CTTATAAGGCTGCTGAAGATGGG - Intronic
1127990482 15:64111721-64111743 CATAAAAGGTTCCTTAAGCCAGG + Intronic
1129683154 15:77669625-77669647 CAGAGAAGGCTCCTGACCCTGGG - Intronic
1132699722 16:1217154-1217176 CAGAAAAGGCTCCGGAAGCAGGG - Intronic
1134093086 16:11401934-11401956 CAGATAAGGCTCCTCAGGCAGGG + Intronic
1135530112 16:23245759-23245781 CAGACAGGGTTCCTGAAGCTGGG - Intergenic
1136968437 16:34943270-34943292 CATAGAATACTCCTGATGCTGGG - Intergenic
1137552023 16:49443948-49443970 CATATGGGGCTCCTGGAGTTGGG + Intergenic
1141290880 16:82717182-82717204 CCAACAAGGCTCCTGAACCTGGG + Intronic
1141299187 16:82797259-82797281 CATATGAGGCTCCAAGAGCTGGG - Intronic
1143069292 17:4277022-4277044 CAGACAAGGTTCCCGAAGCTTGG + Intronic
1143421671 17:6798176-6798198 CAGATTAGGCAACTGAAGCTCGG + Exonic
1144847493 17:18227500-18227522 CATCTCAGCCTCCTGAAGCTGGG + Intronic
1145952914 17:28833753-28833775 CATATAAAGCAACTGAAGCTTGG + Intronic
1147061765 17:37885623-37885645 CATAAAAGCCTACTGAGGCTGGG + Intergenic
1148678732 17:49460503-49460525 CACAGAAGGCTCCTGCTGCTGGG + Intronic
1150195542 17:63294358-63294380 CATTTCAGCCTCCTGTAGCTGGG - Intronic
1153516639 18:5909691-5909713 CATTTCAGGATTCTGAAGCTGGG + Intergenic
1153543293 18:6180291-6180313 CATATAAGGCTACTGAGACAGGG + Intronic
1155645120 18:28068163-28068185 CAAATCAGCCTCCTGAAGCAAGG + Intronic
1157067247 18:44366519-44366541 CATTTAAGTCTCCTGAAGCTGGG + Intergenic
1157382365 18:47231153-47231175 CATATAATCCTCCTGAAACACGG + Exonic
1157685776 18:49641126-49641148 CAAAGAAGCCCCCTGAAGCTGGG - Intergenic
1161920507 19:7262173-7262195 CAAATAAGCCTCCTAAGGCTGGG + Intronic
1164084386 19:21888107-21888129 AATATGGGGATCCTGAAGCTTGG - Intergenic
1164816218 19:31205471-31205493 CGTTTATGGCTCCTGAAACTTGG + Intergenic
1165078264 19:33292792-33292814 CATAAAAGGAAACTGAAGCTCGG + Intergenic
927769208 2:25843686-25843708 CATCTCTGCCTCCTGAAGCTGGG - Intronic
932096191 2:68850908-68850930 CATCTAGGTTTCCTGAAGCTTGG + Intergenic
932911359 2:75809556-75809578 CATATAAGGTTCCTTTAGGTTGG + Intergenic
934709031 2:96503300-96503322 CTGAGAAGGCTCCTGAAGCAGGG - Intronic
938110914 2:128564357-128564379 CATATATGGATCCTGAAGGTAGG - Intergenic
940040473 2:149354583-149354605 CATAGAAAGCTGCTGTAGCTTGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946913044 2:224485677-224485699 CATTTAATTCTGCTGAAGCTGGG - Intronic
947028717 2:225768588-225768610 CAGATGAGGGTCCTGAGGCTTGG + Intergenic
1173993975 20:47323787-47323809 CAAATGAGGCTCATCAAGCTAGG + Intronic
1183376074 22:37466199-37466221 CATAGAAAGCTCCTGATGCGGGG - Intergenic
951713716 3:25613890-25613912 CAGATAAGGATCCTGAAGCTTGG - Intronic
953498692 3:43412140-43412162 CAAATAAGATTCCTGAAGCTAGG + Intronic
953558128 3:43963086-43963108 CATAAAAGCCTCCTGCAGCCAGG + Intergenic
953623444 3:44551849-44551871 CAGATGAGGATCCTGAGGCTTGG - Intergenic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
964209869 3:154214731-154214753 CATACCAGGCTCCTGCTGCTTGG - Intronic
964802499 3:160571097-160571119 CATATAAAATTCCTGAGGCTGGG - Intergenic
965296495 3:166954302-166954324 CCTATAAGACAACTGAAGCTTGG - Intergenic
966181021 3:177188730-177188752 CACATAAATCTCCTGAATCTGGG + Intronic
972818035 4:42666436-42666458 AATATATGGCTGCTGAAGCTGGG - Intergenic
975065834 4:70062408-70062430 CAGCTAAAGCTCCTGAAGATGGG + Intergenic
975294925 4:72723267-72723289 CATCTAAGGCTCGTGAGACTGGG + Intergenic
977599747 4:98923427-98923449 CATTTCAGCCTCCTGAGGCTAGG + Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
980406791 4:132364279-132364301 CATAAGAATCTCCTGAAGCTGGG - Intergenic
981380838 4:144069897-144069919 CAGATAAGGCCCCTCAACCTTGG - Intergenic
982933805 4:161443893-161443915 GATATAAGGCTGCTGAAGGAGGG + Intronic
985275371 4:188233077-188233099 CATTTAAAGCTCCTGAGGCCAGG + Intergenic
992263629 5:74995079-74995101 CATTTAAAACTCCTGACGCTGGG - Intergenic
992833078 5:80614554-80614576 CAGATGAGGCTCCTCAACCTTGG - Intergenic
992863213 5:80933016-80933038 CATCTCAGGCTCCTGAGGATAGG + Intergenic
993568734 5:89509117-89509139 CATGTAGGGCTCCAGAGGCTGGG - Intergenic
994458316 5:100043568-100043590 CTTACAAGACTCCTGTAGCTAGG + Intergenic
999128839 5:149267066-149267088 GATCTTAGGCTCCTGAAGCGAGG - Intergenic
999843246 5:155451268-155451290 CACATAAGGCTGCAAAAGCTGGG - Intergenic
1000770271 5:165344299-165344321 AATATAAGTTTCCTGAAGGTAGG + Intergenic
1003693552 6:8378745-8378767 AATAGGAGGCTCCTGGAGCTCGG + Intergenic
1004192829 6:13479019-13479041 CAAATATGACACCTGAAGCTTGG + Intronic
1004802378 6:19163921-19163943 AATATAAGGCCCCTTGAGCTGGG - Intergenic
1005830478 6:29667148-29667170 CAGACAAGGCAACTGAAGCTTGG - Intronic
1009747355 6:67834511-67834533 AATATAATGCTCATGGAGCTAGG + Intergenic
1011332701 6:86227937-86227959 TATTTAAGTCTGCTGAAGCTGGG + Intergenic
1011804954 6:91061297-91061319 AATATAATGCACCTGAAACTAGG + Intergenic
1016845464 6:148564384-148564406 CATATCTGGGACCTGAAGCTTGG + Intergenic
1017542881 6:155421264-155421286 CAGGTAAGGAACCTGAAGCTTGG - Intronic
1018658066 6:166059164-166059186 CATTTCAGACTGCTGAAGCTTGG - Intergenic
1018836555 6:167488634-167488656 CATCTAAGGAAACTGAAGCTTGG - Intergenic
1019767832 7:2864443-2864465 CATATAAAGTTCCTGAGGTTGGG + Intergenic
1026233103 7:68502591-68502613 CAGATGAGGTTTCTGAAGCTAGG - Intergenic
1026464441 7:70641722-70641744 CATATCAGGCACATGAGGCTGGG - Intronic
1033172174 7:139093935-139093957 AATATTAGGCACCTGGAGCTGGG - Intronic
1033213990 7:139481037-139481059 CATATAAGGCTCCTGAAGCTGGG - Intronic
1035149729 7:156859880-156859902 CCTATAAGTCTCCTGAAGTCAGG - Intronic
1042691320 8:71502689-71502711 CAGATAAGGTGCCTGAAGCATGG + Intronic
1047996470 8:130341502-130341524 CAAGTAAGGGTCCTGAGGCTTGG - Intronic
1049262211 8:141645854-141645876 CGGAGAAGGCTCTTGAAGCTGGG + Intergenic
1050300453 9:4253185-4253207 CGTTTAAGTCTGCTGAAGCTGGG + Intronic
1055354178 9:75420274-75420296 AATGAAAGGCTACTGAAGCTGGG - Intergenic
1058072820 9:100619183-100619205 CGTTTAAGTCTGCTGAAGCTGGG + Intergenic
1061945377 9:133905737-133905759 CAGATGAGGCTCCTATAGCTGGG + Intronic
1062029392 9:134355377-134355399 CATATCAGGAAACTGAAGCTGGG - Intronic
1185921048 X:4093277-4093299 CATATAAGGCTGCAGAAGCAAGG - Intergenic
1188001706 X:24988629-24988651 CTTATAAGGCTTCTAAAGATGGG - Intronic
1188942350 X:36255408-36255430 TCATTAAGGCTCCTGAAGCTGGG + Intronic
1191168482 X:57417802-57417824 CTTTTAAGTCTGCTGAAGCTGGG + Intronic
1192154207 X:68731696-68731718 CATCTCAGCCTCCTGTAGCTAGG + Intergenic
1195838826 X:109150018-109150040 CATGTAAGCCTCCTAAGGCTTGG - Intergenic
1199469770 X:148181613-148181635 CTTTTAAGTCTGCTGAAGCTGGG + Intergenic
1202029916 Y:20560753-20560775 CATAAAAGGAGCCTGGAGCTGGG - Intergenic