ID: 1033221317

View in Genome Browser
Species Human (GRCh38)
Location 7:139527860-139527882
Sequence AAACTACCAAATGTGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033221317_1033221318 4 Left 1033221317 7:139527860-139527882 CCAAACTTCACATTTGGTAGTTT 0: 1
1: 0
2: 3
3: 21
4: 251
Right 1033221318 7:139527887-139527909 CAGTCAAGATTATGCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033221317 Original CRISPR AAACTACCAAATGTGAAGTT TGG (reversed) Intronic
900321280 1:2085492-2085514 CAACCAACAAATGTGAGGTTTGG - Intronic
901856077 1:12044923-12044945 GGACTTCCAAATGTGAATTTGGG - Intergenic
902867864 1:19292354-19292376 AAACTACCAAAGTTTATGTTTGG + Intergenic
903700547 1:25245004-25245026 AAAGTAGCAAATCTGAAGATAGG - Intronic
905076650 1:35277813-35277835 CAACTCCCAAAGGTGAGGTTTGG + Intronic
905687799 1:39921389-39921411 AAGCTACCAAAGTTGAAGTTGGG - Intergenic
906168247 1:43703878-43703900 AGTCTGCCAAATGTGAAGTAAGG + Intronic
906271145 1:44479902-44479924 AAACTAGCAAAGGTGAAGGAGGG - Intronic
906751120 1:48261719-48261741 ATTATACCAAATGTGAAGATTGG - Intergenic
907014447 1:50998323-50998345 AAACTACTAAAAGAAAAGTTGGG + Intergenic
907890715 1:58633813-58633835 AAACTATCAAATGCAAAATTTGG - Intergenic
908127571 1:61046250-61046272 AAGTTACCAAATGTAAGGTTGGG - Intronic
909691922 1:78418552-78418574 AAACTATTTAATATGAAGTTTGG + Intronic
909953207 1:81745165-81745187 AAAAGACCCAATGTGGAGTTAGG + Intronic
910510978 1:88003577-88003599 AAACTACCAAATGTAATGGATGG - Intergenic
912074946 1:105862321-105862343 AGACAACCTAATTTGAAGTTGGG - Intergenic
913117809 1:115712878-115712900 AAAGAACCAAATGTTAAATTTGG + Intronic
916152933 1:161813805-161813827 AAAATACAAAATTGGAAGTTAGG - Intronic
917431221 1:174971629-174971651 AAACTGCAAAATCAGAAGTTAGG - Intronic
918552831 1:185763293-185763315 AAAATTCCAAGGGTGAAGTTTGG + Intronic
918558826 1:185839059-185839081 AAACAATCAAAGCTGAAGTTAGG + Intronic
921716278 1:218420059-218420081 ACACTAACACATGTGAACTTGGG - Intronic
922980641 1:229823609-229823631 AAATTATCAAATGTGATGTGGGG + Intergenic
923926915 1:238639758-238639780 AAATTACCAACTGAGAAGTCAGG + Intergenic
924524929 1:244837534-244837556 AAACTTTAAAATGTGAAATTTGG + Intronic
1065401807 10:25312126-25312148 AAATTTCCACATGTCAAGTTTGG - Intronic
1066791979 10:39075378-39075400 AAAATACAATATGTGATGTTTGG + Intergenic
1066930174 10:41749142-41749164 AAACTACCAAATGAAAAGAAAGG - Intergenic
1068059880 10:52053743-52053765 AAACTATCAAATGAGGAGTGAGG - Intronic
1068370992 10:56113869-56113891 AAAGTACTAAATATCAAGTTTGG + Intergenic
1068911667 10:62384713-62384735 AAACTACCAACTGTCACATTTGG - Intronic
1069361921 10:67652907-67652929 AAACTAGGAAAAGTAAAGTTGGG - Intronic
1072521562 10:96234455-96234477 AAACTACCACCTGTGCACTTTGG - Intronic
1073923948 10:108492272-108492294 AAAATAACAAATGTGAAGACAGG + Intergenic
1074310579 10:112319411-112319433 AAAATACCAATTGGGAAATTAGG + Intergenic
1074995316 10:118752803-118752825 AAACTAGTAAATGTGAAAATTGG - Intronic
1076092858 10:127703431-127703453 AAAGCACCAACTGTCAAGTTAGG + Intergenic
1076121977 10:127943780-127943802 AGACTAGCAAATGTGAGGCTGGG - Intronic
1076581622 10:131515985-131516007 AAAAGCCCAAATGAGAAGTTAGG - Intergenic
1077348424 11:2076064-2076086 AAGCTACCATAAGTGAAGTGAGG - Intergenic
1078039540 11:7846937-7846959 AAACCACTAGAAGTGAAGTTTGG - Intergenic
1079477610 11:20847880-20847902 AACCTACCAAATGGGACCTTAGG + Intronic
1081388409 11:42500584-42500606 AAACATCCAAAAGTGAAGTCAGG + Intergenic
1082297963 11:50467035-50467057 AAACTACCAAATGAAAAGACAGG - Intergenic
1086097961 11:83069516-83069538 AAAAAACCAAATGGGCAGTTTGG + Intronic
1086682740 11:89694276-89694298 AAACTTCCTAGTGTGAATTTAGG + Intergenic
1088631397 11:111777030-111777052 AAATTACCAGAGGTAAAGTTAGG + Intergenic
1089412313 11:118256050-118256072 AAACTCCCTAATGTTAATTTTGG + Intronic
1090297641 11:125603204-125603226 AAAATGCAAAATGTGAGGTTTGG + Intronic
1093225400 12:16477468-16477490 AAACTACTAAAATTTAAGTTAGG - Intronic
1094277889 12:28699490-28699512 GAACTTCCACATGTGAATTTTGG - Intergenic
1095229590 12:39723371-39723393 GAATTAGCAACTGTGAAGTTAGG - Intronic
1095233233 12:39766976-39766998 AAAATACCAAATGAACAGTTTGG - Intronic
1095348985 12:41187889-41187911 AAACTACAAAATCAGAAGTTAGG - Intergenic
1097774247 12:63627843-63627865 AATCTTCCAAGTGTGAAGCTGGG - Intronic
1097972578 12:65650277-65650299 AACCTATCAAATGGGCAGTTTGG - Intergenic
1099832540 12:87863385-87863407 AAAGTACAAAATGTTAATTTTGG - Intergenic
1100213188 12:92419438-92419460 AATCTAACCATTGTGAAGTTTGG - Intergenic
1100386790 12:94111298-94111320 AAACTAAGAAATGAGAAGGTAGG + Intergenic
1101161861 12:101985889-101985911 AAACTACCTAAAATGAAGTCTGG + Intronic
1102836039 12:116061638-116061660 AAATTACCTAATGTGAGTTTGGG + Intronic
1107002998 13:35572933-35572955 AAACAACAAAATATGAAGTATGG + Intronic
1107226644 13:38057165-38057187 AAACTACCAGAGGTGAGGGTGGG + Intergenic
1108967045 13:56321156-56321178 AAACAACCAAATTTGCAGCTTGG + Intergenic
1109153928 13:58880491-58880513 AAAAAACCTAAAGTGAAGTTGGG + Intergenic
1110344881 13:74434483-74434505 AACCTACAAAATGTAAAATTGGG - Intergenic
1111398716 13:87703448-87703470 AAACTACCATTTGAGAAGTATGG - Intergenic
1113297495 13:108975828-108975850 AAACACTTAAATGTGAAGTTAGG - Intronic
1113393475 13:109920388-109920410 TAACTAATGAATGTGAAGTTGGG + Intergenic
1116080724 14:40167956-40167978 AAAATACCAAATGAGAATATAGG - Intergenic
1116159187 14:41246648-41246670 CAACTATGAAATGAGAAGTTTGG - Intergenic
1116966793 14:51023064-51023086 AAATTACCAAATGTGCATTGTGG - Intronic
1118498475 14:66332877-66332899 AAACTACAATATCTGAAATTAGG + Intergenic
1120033206 14:79666199-79666221 AAAGTACAAAATGAGAATTTGGG - Intronic
1120156090 14:81095053-81095075 AATCTACCACATGTGAACCTTGG - Intronic
1124995431 15:34719073-34719095 AAAGTACAAAATGTTAAGTAAGG - Intergenic
1126835217 15:52656282-52656304 AAAAAACAAAATGTGATGTTAGG + Intronic
1128395596 15:67222314-67222336 ATAATACCAAATTTCAAGTTGGG + Intronic
1128749850 15:70141009-70141031 AATCTACAAAATGGGAAGATTGG - Intergenic
1129799295 15:78401620-78401642 AAACTACCAAATGTCAGGCCAGG - Intergenic
1131205954 15:90447372-90447394 AAACTAGAAAATGGGAAGTAGGG - Intronic
1131503024 15:92988691-92988713 GAACTGCCAAATCTGAAGATAGG - Intronic
1138021607 16:53487835-53487857 AAACCACCAAATGTAAAAGTGGG + Intronic
1138460534 16:57145039-57145061 AAAATACAAACTGTGAAGTGGGG - Intronic
1138983453 16:62298418-62298440 AAACAAACAAATCTGAGGTTTGG + Intergenic
1139638011 16:68270578-68270600 AAATTACCAAATGTCAAGTGTGG - Intronic
1140969756 16:80001647-80001669 AAACTCCCTAATATAAAGTTTGG - Intergenic
1142637556 17:1267624-1267646 AAACCACCAAATGTGAGGCCAGG - Intergenic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1144152258 17:12460642-12460664 AATTTTCCAAATGTAAAGTTAGG - Intergenic
1144419382 17:15082263-15082285 GAAGTAGCAAAGGTGAAGTTGGG - Intergenic
1144922652 17:18777532-18777554 AAAAAAGAAAATGTGAAGTTGGG - Intronic
1146089892 17:29866310-29866332 AAACTACCAAAAGCAAAGTGGGG + Intronic
1149031713 17:52091177-52091199 ATACAACCAAATGTTAAGTGAGG + Intronic
1149372767 17:56011488-56011510 AAACTCCCAAATGTTAAGTGGGG - Intergenic
1151635848 17:75347313-75347335 AGCCTACCAAATGGGAAGATGGG - Intronic
1152166403 17:78710594-78710616 AATCTACCAAATATCAAATTAGG + Intronic
1152489551 17:80620782-80620804 AACTTACCAAATTTGAAATTAGG + Intronic
1152971220 18:163096-163118 TAACTATGAAATGAGAAGTTAGG + Intronic
1153109524 18:1567878-1567900 GACATACTAAATGTGAAGTTGGG - Intergenic
1153364386 18:4237573-4237595 AAACTAACAAATTTGAAGAGAGG - Intronic
1155550540 18:26960413-26960435 GAACTAGCAAATTTGAAGTTTGG + Intronic
1159042393 18:63336762-63336784 AAACTACCATTTGTTGAGTTTGG + Intronic
1159270874 18:66148524-66148546 AAAATAGCAAATCTGAAGTTAGG - Intergenic
1160220217 18:76971114-76971136 AAGATACCAAACGTGAAGGTGGG + Intergenic
1162598768 19:11650690-11650712 AAATTAACAAATTTGAAGCTGGG - Intergenic
1168045285 19:53789942-53789964 AACCTTCCAAATATGAACTTAGG - Intergenic
927921360 2:26974417-26974439 AGAAAAGCAAATGTGAAGTTGGG + Intronic
929903786 2:46028387-46028409 AAACTGCCAAATGAAATGTTTGG - Intronic
930595314 2:53380117-53380139 AAACTACCACTTGTCGAGTTTGG - Intergenic
930896862 2:56456572-56456594 TAATCCCCAAATGTGAAGTTAGG - Intergenic
930931625 2:56890931-56890953 AAACTTCCAAAAGTAAAGATAGG - Intergenic
931310766 2:61078293-61078315 AAACTACCATTTGTCAAGTTTGG + Intronic
931686353 2:64797258-64797280 AAAAAAAGAAATGTGAAGTTGGG + Intergenic
931870144 2:66447386-66447408 ACACAATCAAATGTAAAGTTAGG - Intronic
932064710 2:68542462-68542484 AAATTACCCAATTTGAAATTGGG + Intronic
934924323 2:98371360-98371382 AAACAACCAAATGTGCCTTTGGG - Intronic
935427592 2:102936277-102936299 AAACTAGGACATGTGAACTTTGG + Intergenic
936784686 2:116080288-116080310 AAGATACCAAATTTCAAGTTAGG + Intergenic
937947689 2:127354723-127354745 AAAGTACCAAATATGAAGAGAGG + Intronic
939169941 2:138683803-138683825 AAATTAACAAATGTCATGTTTGG - Intronic
939311624 2:140485693-140485715 AAATTACCTAATGTGTAATTAGG + Intronic
939566869 2:143795463-143795485 AAACTGCCAAGTGTGAAGCTTGG - Intergenic
939784409 2:146492337-146492359 AAAGCACAAGATGTGAAGTTCGG - Intergenic
940651292 2:156443558-156443580 AAACTGCCAAATGTGTAGGGAGG - Intronic
941966858 2:171309415-171309437 AAACCAGCAATAGTGAAGTTAGG + Intergenic
942239858 2:173951702-173951724 AAACTGCCACCTGTTAAGTTTGG - Intronic
942426606 2:175866856-175866878 ACAATATCAAATGTGAAGATGGG - Intergenic
942813880 2:180028624-180028646 AAACTACCACATGAAAACTTTGG - Intergenic
943142067 2:183995163-183995185 AAACTACCATTTGTTGAGTTTGG + Intergenic
945029756 2:205652291-205652313 AAACCACCATCTGAGAAGTTTGG + Intergenic
946782695 2:223207168-223207190 AAACAACCTAATATGAATTTGGG + Intergenic
1169882104 20:10358031-10358053 AAACAACCAAATATAAAATTTGG - Intergenic
1172082427 20:32352628-32352650 TAATAACTAAATGTGAAGTTGGG - Intergenic
1172376692 20:34447953-34447975 AAACAACCAAATGTAACGTAAGG + Intronic
1173696194 20:45015780-45015802 AAACTACAAAATAGGAACTTTGG - Intronic
1174663021 20:52231504-52231526 ACATAACCAAATGTGAACTTTGG + Intergenic
1176003141 20:62843197-62843219 TATCAACCAAATGTGATGTTTGG + Intronic
1177014875 21:15774087-15774109 AAATTACCATCTGTTAAGTTTGG - Intronic
1177636606 21:23795591-23795613 ATACTAACAAATGAGAAATTAGG - Intergenic
1178598766 21:33978000-33978022 AAACAACCTAATGTCAAGTTAGG + Intergenic
1181857405 22:25791964-25791986 AAAGTACCAAATTTAAAGTCAGG - Intronic
1182559294 22:31147215-31147237 AAAATACAAATTGTCAAGTTTGG + Intergenic
949419938 3:3855071-3855093 CAACTACCAAAGGTCAGGTTAGG + Intronic
950836018 3:15919665-15919687 AAACAAGCAAAAGGGAAGTTGGG - Intergenic
951390794 3:22100930-22100952 AAAATAGTAAATGTGAAGTCAGG + Intronic
952768748 3:36978024-36978046 GAACTACCTAAAGTGAAGCTGGG + Intergenic
954799283 3:53177862-53177884 AAACTGGAAAATGTGATGTTGGG - Intronic
954886091 3:53875293-53875315 AAACTACCTAATGTGGAGGACGG + Intronic
957357118 3:79104318-79104340 AAACTACCTTACTTGAAGTTAGG + Intronic
957875231 3:86136904-86136926 AAAATACAAAGAGTGAAGTTAGG - Intergenic
957922526 3:86763946-86763968 AAAATAACAAATCAGAAGTTTGG - Intergenic
958804618 3:98794902-98794924 AAAATATAAAAAGTGAAGTTGGG + Exonic
959355184 3:105317883-105317905 AAACCATTAAATGTGGAGTTGGG - Intergenic
960566445 3:119137605-119137627 AAACTACCAAAAGAAAACTTTGG + Intronic
960986349 3:123283602-123283624 AAACTGCCAAATCTGAAATGAGG + Exonic
962024286 3:131530934-131530956 AAACTACCACTTGTTGAGTTTGG + Intergenic
962623949 3:137206323-137206345 AAGCCACAAAATGTGAATTTGGG + Intergenic
963133478 3:141878685-141878707 AAACTAGTACAAGTGAAGTTGGG + Intronic
963291647 3:143496325-143496347 AAACTTCCAAATGAGAAGTCTGG - Intronic
963293522 3:143518987-143519009 AAATCAACAAATGTCAAGTTTGG - Intronic
965374785 3:167909849-167909871 AAGCTGCCAAATTTGAAGTGGGG + Intergenic
970087201 4:12363546-12363568 ACACTACAAATTGTGAATTTTGG + Intergenic
970269089 4:14324032-14324054 AAACTACAAAAAGAGAACTTAGG + Intergenic
970753897 4:19400585-19400607 AAAATAGCAAATGAGAACTTAGG - Intergenic
970841836 4:20481501-20481523 AAACCTACAAATGTGAATTTTGG - Intronic
971660595 4:29409465-29409487 AAATTACAAAATGTGAACTGAGG - Intergenic
972126135 4:35768352-35768374 AAATTACCAAATGCTAAATTAGG + Intergenic
972439255 4:39069643-39069665 AAAATACCAACTGTTAATTTGGG + Intronic
972942110 4:44208543-44208565 ATAATACCAAATAAGAAGTTTGG + Intronic
974241019 4:59247261-59247283 AACCTACCAATTTTGAAGTTTGG + Intergenic
975194704 4:71510074-71510096 AAACTCCCTAATCTGAATTTTGG + Intronic
976072864 4:81261532-81261554 ACCCCACTAAATGTGAAGTTAGG + Intergenic
976481247 4:85548525-85548547 AATATAACAAATGTGAAGTTAGG - Intronic
976598770 4:86918653-86918675 CAACTACCAAAGGGGAACTTAGG + Intronic
976789641 4:88863505-88863527 AAATTATCAAACCTGAAGTTGGG + Intronic
977211301 4:94221409-94221431 AAATTACCACCTGTCAAGTTTGG + Intronic
977625107 4:99181328-99181350 AAACTACCAAAAGAAAACTTTGG - Intergenic
978547119 4:109882560-109882582 TAACCAACAAATGTGAAGTAAGG + Intergenic
978964923 4:114729138-114729160 AAACAACTAAATTTGAAGTTTGG - Intergenic
979845894 4:125511307-125511329 AAGTTACTAACTGTGAAGTTTGG + Intergenic
984361463 4:178740184-178740206 CAAATACTAAATGTGAAATTTGG - Intergenic
988736962 5:34032249-34032271 AAACTTGTAAATGTGAGGTTAGG - Intronic
990062054 5:51662876-51662898 TAACTAACAAATGTGAAATATGG - Intergenic
990773094 5:59272942-59272964 AAACTTCCAAACGTAATGTTTGG + Intronic
990833285 5:59985108-59985130 AAAAAACGAAAGGTGAAGTTCGG - Intronic
991142505 5:63260888-63260910 AAACTACCCAAAATCAAGTTCGG - Intergenic
992650842 5:78858346-78858368 ACTCTAGCAAATGTGAAATTTGG - Intronic
995354948 5:111226327-111226349 AAACTGAGAAATTTGAAGTTTGG + Intronic
997029420 5:130107609-130107631 ATACTACAAAGAGTGAAGTTAGG - Intronic
997332464 5:133075020-133075042 AAATTACCAAATATTTAGTTTGG - Intronic
998302968 5:141043556-141043578 AAAATACAAAATATGAAGTAGGG + Intergenic
1003629809 6:7776600-7776622 CAACTACCAATAGTAAAGTTGGG - Intronic
1004549487 6:16632723-16632745 AACCTAGAAAATGTGAAATTGGG + Intronic
1004738031 6:18427940-18427962 AATTTACCAAATGTGAAGTTAGG + Intronic
1005483676 6:26278779-26278801 AAACTCCCAATAGTGTAGTTAGG + Intergenic
1006698646 6:35953716-35953738 AATCTACAAAATGAGAGGTTTGG - Intronic
1006783326 6:36647642-36647664 AAACCACCTAATGAAAAGTTTGG - Intergenic
1007921408 6:45613149-45613171 AAACAACCCAATATGAAATTGGG - Intronic
1008466819 6:51840780-51840802 AAAGTACGAATTGTGAAGTAAGG - Intronic
1010396763 6:75401717-75401739 ACACTGCCAAATTTGAAGCTTGG - Intronic
1011350273 6:86415385-86415407 AAACATACAAATGTGATGTTTGG - Intergenic
1011827231 6:91323063-91323085 AAATTATCAAATCTGAAGGTTGG - Intergenic
1012076911 6:94699680-94699702 AACTTATCAAATGTGAGGTTGGG + Intergenic
1012942735 6:105433038-105433060 AAAATACCAAATGTGAAGTCCGG - Intergenic
1013146377 6:107398083-107398105 AAACTACCACCTGTCAAATTTGG + Intronic
1013328736 6:109075788-109075810 AAACTACCAAATTTGTAATGAGG + Intronic
1013408353 6:109862269-109862291 CAACTACCATCTGAGAAGTTTGG + Intergenic
1013437813 6:110130050-110130072 TGACTAACAAATGAGAAGTTTGG + Intronic
1013674151 6:112438497-112438519 ATTCTGCCAAATGAGAAGTTTGG + Intergenic
1014322014 6:119942150-119942172 AAAGTAGCAAATGTTAGGTTGGG + Intergenic
1014458994 6:121672601-121672623 AAACTATAAAATGTAAAGATAGG + Intergenic
1014459345 6:121677025-121677047 AAACTACCAACTGTAAAATCAGG + Intergenic
1014553841 6:122821579-122821601 CCACTCCCAAATGTGAAATTTGG + Intergenic
1015107279 6:129551692-129551714 AAGCTACAAAATGTGCAATTTGG + Intergenic
1016106873 6:140173848-140173870 CAACTACCAAATGTGCATTTTGG - Intergenic
1017408725 6:154147328-154147350 AAACTTCCAAAAGGCAAGTTAGG + Intronic
1018026155 6:159807801-159807823 AAACTACCACTTGTTGAGTTTGG + Intronic
1018160790 6:161040740-161040762 AAACCAGCAAATGTGGAGTTGGG - Intronic
1018209091 6:161463061-161463083 AAACTACCTAATGAGAATTATGG + Intronic
1018710015 6:166491784-166491806 GAACTAACAAATGTTAAGTTTGG - Intronic
1021124255 7:16832352-16832374 AAACTACCAAATGAGAACATTGG + Intronic
1022389775 7:29933343-29933365 ACATCACCAAATGTGGAGTTGGG + Intronic
1022933814 7:35151575-35151597 AATCTTCCAAGTGTGAAGCTGGG - Intergenic
1023736275 7:43238552-43238574 AAAGTGTCAAATGGGAAGTTAGG + Intronic
1024757752 7:52556160-52556182 AAACTTTCACATGTGAATTTTGG - Intergenic
1025309726 7:57917275-57917297 AAACTACTCAATGAGAAGTAAGG - Intergenic
1025518681 7:61689833-61689855 AAACTGCCAAATGAAAAGTAAGG + Intergenic
1025543006 7:62118480-62118502 AAACTGCCAAATGAAAAGTAAGG + Intergenic
1025589950 7:62845571-62845593 AAACTACCAAATGAAAAGAAAGG - Intergenic
1026121327 7:67540488-67540510 AAAATACCAAATGTTATGTGTGG - Intergenic
1026302536 7:69110285-69110307 AATCTACGAACTGTGATGTTAGG + Intergenic
1029829745 7:103244355-103244377 AATCTTCCAAGTGTGAAGCTGGG - Intergenic
1030442302 7:109601485-109601507 AAAATACAAAATGTAAAGTAGGG - Intergenic
1031336890 7:120545697-120545719 AGACTACAAAATGTGATGTAGGG + Intronic
1031546910 7:123062303-123062325 AGACTAGGAAATGTGAAGTATGG - Intergenic
1031897078 7:127362937-127362959 AAACTACTAAAAGTGGAGATGGG + Intronic
1032843297 7:135731285-135731307 AAAGTACAAACTGTGAAGATAGG + Intronic
1033221317 7:139527860-139527882 AAACTACCAAATGTGAAGTTTGG - Intronic
1034331902 7:150290061-150290083 AAACTTGCAAATGTGGAGCTGGG - Intronic
1034666136 7:152819809-152819831 AAACTTGCAAATGTGGAGCTGGG + Intronic
1035892665 8:3362510-3362532 AATCAGCCAAATGAGAAGTTGGG - Intronic
1035901607 8:3462857-3462879 AAACCATCAAATTTGAGGTTAGG - Intronic
1039032285 8:33323653-33323675 AGCCTACCAAATCAGAAGTTTGG + Intergenic
1039371632 8:36989999-36990021 AAATTACTAAATGTGAAGATAGG - Intergenic
1041124565 8:54621938-54621960 GAAATACCAAATGTCAAGGTTGG - Intronic
1042157382 8:65859604-65859626 AAACTACCATTTGTGAAGTTTGG + Intergenic
1044511820 8:93090155-93090177 AAACTACCAATGTTGAATTTGGG - Intergenic
1044556898 8:93572505-93572527 AAACTCCCAACTGTGAAGCTAGG + Intergenic
1045371325 8:101526208-101526230 AAACTACCAGTTTTGAATTTTGG - Intronic
1048019976 8:130529175-130529197 AAAATTCCAAATTTGAAGTGTGG + Intergenic
1049386663 8:142346213-142346235 AAAGTACAAAATGGGAAGTGCGG + Intronic
1050054034 9:1632945-1632967 AAAATGCCAAATTTGAAGTATGG - Intergenic
1051317802 9:15861643-15861665 CAACGACAAAATGTGAAGGTAGG - Intronic
1052394052 9:27916137-27916159 AAACTACCACATCTGCAGTATGG - Intergenic
1055394697 9:75861715-75861737 AAATTAGCAAAAGTGAAGTTTGG + Intergenic
1055554203 9:77459268-77459290 AAAATAGCAAATGTTATGTTAGG + Intronic
1055724074 9:79208844-79208866 AAACCTTCAAATGTGAAGTTGGG + Intergenic
1057348552 9:94274929-94274951 AAAATTCCAAATCTGAAGTAGGG + Intronic
1057679583 9:97166355-97166377 ATACAAACAAATGTGAAGTAAGG - Intergenic
1058811869 9:108647558-108647580 AAACATCCAAATGTATAGTTTGG + Intergenic
1059605662 9:115832318-115832340 TCACTGCCATATGTGAAGTTAGG + Intergenic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1186856244 X:13628824-13628846 AAACAAACAAATGAAAAGTTTGG + Intronic
1188446474 X:30257837-30257859 AAAGTAGAAAATGTGAATTTGGG + Intergenic
1189108313 X:38259698-38259720 AAACTGCCAAATTAGAATTTCGG - Intronic
1192388418 X:70698184-70698206 AAACAACTAAAAGTGAAATTGGG - Intronic
1192875387 X:75224077-75224099 AAACAACCAAATGGGAATTCTGG - Intergenic
1193761184 X:85468156-85468178 AAACTACTAAAAGAGAACTTTGG + Intergenic
1194178268 X:90680237-90680259 AAACTACAATTTGTGAATTTTGG - Intergenic
1195483155 X:105371541-105371563 TATATACCAAATATGAAGTTTGG - Intronic
1197360705 X:125499433-125499455 AAACTACCAAAAGAAAACTTTGG - Intergenic
1198146524 X:133862901-133862923 AAACTACCCTACGTGATGTTTGG - Intronic
1198455714 X:136815706-136815728 ATACTATCAAATATGAATTTGGG + Intergenic
1199109043 X:143908635-143908657 AAACTAGCAGATGAGCAGTTTGG - Intergenic
1200524931 Y:4262397-4262419 AAACTACAATTTGTGAATTTTGG - Intergenic