ID: 1033221895

View in Genome Browser
Species Human (GRCh38)
Location 7:139532450-139532472
Sequence CATCCAGGGTCTCCCCACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033221895_1033221901 -5 Left 1033221895 7:139532450-139532472 CCGGTGTGGGGAGACCCTGGATG 0: 1
1: 0
2: 3
3: 16
4: 162
Right 1033221901 7:139532468-139532490 GGATGGCAGCTGGGCTTAGAAGG 0: 1
1: 0
2: 2
3: 22
4: 217
1033221895_1033221902 17 Left 1033221895 7:139532450-139532472 CCGGTGTGGGGAGACCCTGGATG 0: 1
1: 0
2: 3
3: 16
4: 162
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033221895 Original CRISPR CATCCAGGGTCTCCCCACAC CGG (reversed) Intronic
900170000 1:1262550-1262572 CATCCAAAGCCTCCACACACAGG + Intronic
900514111 1:3073206-3073228 CAGCCAGGGGCTCCCCCCACCGG + Intronic
901661097 1:10798332-10798354 CATTCAGGATCTGTCCACACAGG + Intergenic
902173934 1:14635328-14635350 CATCCCTGGTCTCCACCCACTGG + Intronic
902618676 1:17638041-17638063 AATCCAGGCACTGCCCACACTGG - Intronic
903022578 1:20404530-20404552 CATACCATGTCTCCCCACACTGG + Intergenic
909629718 1:77759296-77759318 CTTCCTCGGTCTCCCCACTCAGG - Intronic
912430977 1:109628247-109628269 CATCCAGCGTGTCCACACTCAGG - Exonic
913476089 1:119239471-119239493 CATCCAGGGTCACCACACATTGG + Intergenic
917589737 1:176463772-176463794 CCTCCATGGTCTCCCTGCACAGG - Intronic
919887098 1:201942508-201942530 CCTCCAGGGTCTCCCTCCAAGGG - Intronic
922215420 1:223516185-223516207 CCTCCCGGGATTCCCCACACGGG + Intergenic
922795594 1:228338021-228338043 CATCCAGGACCTCCACATACTGG - Exonic
1067438353 10:46294366-46294388 CACCCAGGGGCTCCCCAGTCTGG - Intronic
1067442138 10:46314555-46314577 CATCCCCTGTCTCACCACACTGG - Intronic
1067544489 10:47183302-47183324 GGTCCAGGGTCTGCCCACATGGG - Intergenic
1070987877 10:80703649-80703671 CATCCTGTCTCTCACCACACTGG - Intergenic
1072610350 10:97013748-97013770 CATCCGGGGTGCCCACACACTGG + Exonic
1076795021 10:132794188-132794210 CAGCCAGTGCCTCCCCACAATGG + Intergenic
1077022842 11:426872-426894 CAACCAGGGACTCAGCACACAGG + Intronic
1077030363 11:462770-462792 CACACAGGGTGTCCCCACACAGG + Intronic
1080315490 11:30943135-30943157 CATCTAGGGTCTCCCGACTGTGG - Intronic
1081203576 11:40248411-40248433 CATCCATGGTCTCCCTCCACTGG + Intronic
1081416661 11:42823457-42823479 TATCCAGGGTTTTACCACACAGG - Intergenic
1084177482 11:67430781-67430803 CATCCCTGGTCTCCACCCACCGG - Intronic
1084410054 11:69001679-69001701 CATCCAGGGACTCCCCACAGTGG - Intergenic
1084411415 11:69008321-69008343 CATCCAGCATCTCCCCTCAAAGG + Intronic
1085083483 11:73651861-73651883 CATCCTTGGTCTCCGCACAGAGG - Exonic
1089292141 11:117443807-117443829 AATCCTGGTTCTCCCCAGACAGG - Intronic
1089981489 11:122776598-122776620 CTTCCAGGGTATCCCTACCCAGG + Intronic
1091320209 11:134644142-134644164 TATCCAGGGCCTACACACACCGG - Intergenic
1091684999 12:2555314-2555336 CATCAAGGGGCACCCCAGACAGG + Intronic
1091804618 12:3346854-3346876 CTTCCAGGGTATACCCAGACTGG + Intergenic
1093171270 12:15863475-15863497 CAGCCAGGCTCTCCACTCACTGG + Intronic
1093533255 12:20192448-20192470 CATCCAGGCTCTACCTACAGTGG + Intergenic
1094448840 12:30562399-30562421 CATACAGAGTTTCCACACACAGG - Intergenic
1096118284 12:49069270-49069292 CACCCAGGGTCTCCGCACTTTGG + Intronic
1096792292 12:54052844-54052866 CAAGCAGGCTCTACCCACACAGG + Intronic
1097167394 12:57093161-57093183 CATCCAGACTCTCCCCAGACAGG - Exonic
1104323651 12:127775003-127775025 CCTCCAGGCCCTCCCCACGCTGG - Intergenic
1105277294 13:18943590-18943612 CACCCTGTGTCTCCCCCCACCGG - Intergenic
1105404690 13:20123674-20123696 TATCCAGGGCATCCCCAGACAGG + Intergenic
1105779539 13:23695053-23695075 CAGCCAGTGTCTCCCGACCCCGG - Intergenic
1106258811 13:28046037-28046059 CATCCCGGGTCTCCTCCCACTGG - Intronic
1107536934 13:41344527-41344549 CATCCCTGGCCTCCACACACTGG - Intronic
1108052648 13:46461420-46461442 CATCAAGGGTGTACACACACGGG + Intergenic
1109246652 13:59962587-59962609 CAACGAGGGACTCCCCTCACAGG + Intronic
1112448435 13:99488362-99488384 AATGCAAAGTCTCCCCACACTGG - Intergenic
1113772104 13:112916949-112916971 CCTGCACGCTCTCCCCACACTGG + Intronic
1121025684 14:90614587-90614609 CATCAATGCTCTCTCCACACTGG - Intronic
1122236383 14:100332825-100332847 CAACCAGCTTCTCCCCTCACCGG - Intergenic
1122875260 14:104660919-104660941 CAGCCTGGGTCTCCCTCCACGGG + Intergenic
1123118272 14:105904562-105904584 CATCCCGGGTTTCCCCAGGCTGG - Intergenic
1127973157 15:63977982-63978004 CATCCACGCTCTCCTCACAGTGG + Intronic
1128285459 15:66433133-66433155 TCTCCAAGGTCTCCCCACAAAGG - Intronic
1128958414 15:71973946-71973968 CATTCAGGGTCTTCCCACTAAGG - Intronic
1129490698 15:75922716-75922738 CTTCCAGTGTCTCCCCACACAGG - Intronic
1129744323 15:78007658-78007680 CATCCAGGGGCTGGCCACACTGG + Intronic
1130017857 15:80201490-80201512 CTCACAGGGACTCCCCACACTGG + Intergenic
1130018022 15:80202232-80202254 CAGCCAGTGCCTCCCCAGACTGG + Intergenic
1130953020 15:88606729-88606751 CTTCCAGGATTTCCCCAGACGGG - Intergenic
1130968826 15:88717075-88717097 CAGCCATGGTCTCCCAGCACGGG - Intergenic
1134631470 16:15759265-15759287 CAAGCAGGCTCTCCCCTCACGGG - Intronic
1136578664 16:31139243-31139265 CCCCCAGTGGCTCCCCACACTGG - Exonic
1138341105 16:56289604-56289626 CATCCTTCCTCTCCCCACACCGG - Intronic
1142503956 17:351078-351100 CACCCACGGCCTCCCCACAGAGG + Intronic
1142519758 17:496722-496744 CATCAGGGGACTCCCCACACTGG - Intergenic
1142521711 17:509654-509676 CATCCTGGCTCGCCCCTCACTGG + Exonic
1143321491 17:6071471-6071493 GATCCAGCTGCTCCCCACACTGG + Intronic
1143982312 17:10880495-10880517 CATCCAGGTTTTCCTCACGCTGG - Intergenic
1145964024 17:28904113-28904135 CTTCCGTGTTCTCCCCACACAGG + Intergenic
1147979214 17:44264549-44264571 CATACAGGGTCTTCGCACTCAGG - Intronic
1152309629 17:79541932-79541954 CCTCCAGGGTCCCCACGCACTGG + Intergenic
1156125088 18:33894821-33894843 CATTCCATGTCTCCCCACACTGG - Intronic
1156656870 18:39298703-39298725 CCTCCTGCGTCTTCCCACACTGG + Intergenic
1157404289 18:47410324-47410346 AATTCATGTTCTCCCCACACTGG - Intergenic
1157496156 18:48158919-48158941 ATTCCTGGGCCTCCCCACACAGG + Intronic
1161328694 19:3676005-3676027 CGACCAAGCTCTCCCCACACAGG + Intronic
1161686216 19:5703974-5703996 CATCTACGTTCTCCCCCCACAGG + Intronic
1162124234 19:8490648-8490670 CCTCCAGGATCTCCCCGCGCCGG + Exonic
1162337945 19:10073208-10073230 CCCCCAGGGTGACCCCACACTGG - Intergenic
1162662658 19:12182449-12182471 CATCCAGGGGCTCCCCTGAGGGG - Intronic
1165833234 19:38739782-38739804 CAGCCAGGCTCTCCCCTCATGGG - Intronic
1165843861 19:38805652-38805674 CAGCCAGGGCCTCCCCATCCCGG + Intronic
1166557892 19:43713547-43713569 CAGCCAGGCTCTGCCCCCACAGG - Intergenic
1167618368 19:50548449-50548471 CCTTCTGGGCCTCCCCACACCGG - Intronic
1168130013 19:54312056-54312078 CCTCCAGGGTCCCCTGACACCGG + Exonic
1168474396 19:56665429-56665451 CGTCCCTGGTCTCTCCACACTGG + Intronic
925140561 2:1547230-1547252 CACACAGGGTGGCCCCACACAGG + Intergenic
925179644 2:1808738-1808760 CATCCAGGGTTTCTCCACCCAGG - Intronic
925317192 2:2935589-2935611 CATCCAAGGCCTCTGCACACAGG + Intergenic
925740764 2:7004226-7004248 CATCCAGGGTCTCCTCACTGTGG + Intronic
928376724 2:30780959-30780981 AATCCAGGTTCTCATCACACTGG - Intronic
929576672 2:43056659-43056681 CATCCAGAGTCACCCACCACAGG + Intergenic
930722396 2:54649968-54649990 CATCCAGGCTCTGGGCACACAGG + Exonic
932563843 2:72893588-72893610 AATCCATGGCCTCACCACACTGG - Intergenic
936081359 2:109434738-109434760 CATTCAGGATCCCCCCTCACAGG + Intronic
936943995 2:117914252-117914274 CCTCCAGTGGCTCCCCACACAGG + Intergenic
937953910 2:127408504-127408526 CGGCCAGACTCTCCCCACACCGG + Intergenic
938291657 2:130153854-130153876 CAGCCGGGCTCTCCGCACACTGG + Exonic
938301093 2:130213625-130213647 CATCCAGCGGCTCCCCTCGCCGG + Intergenic
938455623 2:131460842-131460864 CATCCAGCGGCTCCCCTCGCCGG - Intergenic
938464894 2:131519109-131519131 CAGCCGGGCTCTCCGCACACTGG - Intergenic
939580514 2:143940734-143940756 CCCCCAGTGTCTCCCCACACAGG - Exonic
939868548 2:147502474-147502496 CCTCCAGTCTCTCCCCACTCTGG + Intergenic
939933304 2:148258511-148258533 CGTCCAGTGTCCCCCCAAACTGG + Intronic
947745788 2:232506670-232506692 CAGCCAGTGTTTCCCCACCCAGG - Intergenic
948137507 2:235647814-235647836 CCACCAGGGTCTCCACACACTGG - Intronic
948861201 2:240753350-240753372 CATCCTGGCTCTCTCCACAAGGG + Intronic
1170588862 20:17755957-17755979 TCTCCAGGGTCTCCCCACCATGG - Intergenic
1170658646 20:18315249-18315271 ACTCCAGGGTCTCCCCTCAGAGG - Exonic
1171472431 20:25382860-25382882 CAGCCAGGGACTGGCCACACTGG - Intronic
1175545610 20:59775933-59775955 CATCCCTGGCCTCTCCACACTGG + Intronic
1176177400 20:63735232-63735254 TCTGCAGGGTCTCCACACACTGG - Exonic
1176343118 21:5716346-5716368 CATCCTGGCTTTCCCCACAGGGG - Intergenic
1176475372 21:7148497-7148519 CATCCTGGCTTTCCCCACAGGGG - Intergenic
1176501709 21:7608110-7608132 CATCCTGGCTTTCCCCACAGGGG + Intergenic
1176537439 21:8114415-8114437 CATCCTGGCTTTCCCCACAGGGG - Intergenic
1178500784 21:33124068-33124090 CATCGAGGGTCTCCCTGCAGGGG - Intergenic
1178827396 21:36028336-36028358 CATCCTGGCTCTGCCCACAGAGG - Intergenic
1178944411 21:36934291-36934313 CATCCCTGGTCTCTCCCCACTGG - Intronic
1179276792 21:39899289-39899311 CACCCAGAGTCTCACCTCACCGG - Intronic
1182258957 22:29058981-29059003 CATCCATGGTCTCCCCACAGAGG - Exonic
1184769397 22:46588792-46588814 CATCCAGGCTCTGCCCAGCCCGG - Intronic
1184828507 22:46969343-46969365 CATCCAGGGATGCCACACACAGG - Intronic
1185216432 22:49602373-49602395 CATCCAGGGCCTCGCTACAGCGG - Intronic
1185268820 22:49918955-49918977 CATCCGGGGTCGCCCCACCTTGG + Intronic
1203242382 22_KI270733v1_random:30771-30793 CATCCTGGCTTTCCCCACAGGGG - Intergenic
949351402 3:3127501-3127523 CATCCTCGTTCTCCCCATACGGG - Intronic
953637672 3:44676583-44676605 CAGCCAGTCTCTCCCCTCACTGG - Intergenic
958897754 3:99848562-99848584 TATTCAGAGTCTCCCCAGACCGG - Exonic
961965852 3:130901932-130901954 CATCCCTGGTCTCTACACACTGG - Intronic
963769845 3:149378728-149378750 CTTCCACAGGCTCCCCACACAGG + Intergenic
967638041 3:191828081-191828103 GATCCTGGGTCTCTCCACTCTGG - Intergenic
969696841 4:8739886-8739908 CCTCCTGGGCTTCCCCACACAGG - Intergenic
970233148 4:13931847-13931869 CATCCAGGGGATCCCCATCCAGG - Intergenic
979620987 4:122798372-122798394 CATCCAGGGCCTCCCTGCAGAGG + Intergenic
982123892 4:152167981-152168003 GGTCCAGGGTCTTCCCCCACTGG + Intergenic
982503049 4:156183406-156183428 CTTCCATGGTCTCCCCTCATAGG - Intergenic
985726164 5:1516774-1516796 CCAGCAGTGTCTCCCCACACAGG + Intronic
986259938 5:6135110-6135132 CCTCCAGAGCCTCCACACACTGG + Intergenic
993858879 5:93109543-93109565 CATGCAGGGGCTCCACACATAGG + Intergenic
998510925 5:142713354-142713376 CCTCCTGGGTCTCCCCTCGCAGG - Intergenic
1000039648 5:157475812-157475834 CAACCAGGGTCTGCCCAACCAGG + Intronic
1001603615 5:172944848-172944870 CATCCAGGGTCTCCCCCTCCAGG + Intronic
1002192918 5:177488169-177488191 CTTCCAGGACCTTCCCACACTGG + Exonic
1002809226 6:610457-610479 CATCCTGGGTCTCATTACACAGG + Intronic
1002885018 6:1285852-1285874 CAGTCAGAGGCTCCCCACACTGG + Intergenic
1006188201 6:32192147-32192169 CCTCCAGGGACCCGCCACACAGG - Exonic
1006412472 6:33882431-33882453 CATCCAGGTGCTCCCCATGCTGG - Intergenic
1011445295 6:87432713-87432735 CTTCCAGGGTCTCCCAACTCTGG + Intronic
1013074102 6:106755243-106755265 CACCCAGGATCCCCTCACACAGG - Intergenic
1014514269 6:122361897-122361919 CATCCAGTGTCCCCCCAAGCCGG - Intergenic
1017299105 6:152835161-152835183 CATACAGAGTTTCCACACACAGG - Intergenic
1023482032 7:40644773-40644795 CACACAGGGTCTGCCCACAAAGG - Intronic
1024053826 7:45646820-45646842 CATCCAGGGTCTGGCCACTTAGG - Intronic
1026186973 7:68089965-68089987 CATACAGAGTTTCCACACACAGG + Intergenic
1030147713 7:106373197-106373219 CCTCCAGGGCCTCTCCACATGGG - Intergenic
1033221895 7:139532450-139532472 CATCCAGGGTCTCCCCACACCGG - Intronic
1034544643 7:151781794-151781816 CATCCAAGTTCTGACCACACAGG + Intronic
1034692209 7:153022993-153023015 AACCCAGGGTGGCCCCACACGGG - Intergenic
1035202654 7:157277184-157277206 CTTTCTGCGTCTCCCCACACCGG + Intergenic
1036183224 8:6602464-6602486 CATCCAGATTCTCCCCAGAGAGG - Intronic
1037027594 8:14058649-14058671 CACCCAGGGACTCCCGACAGTGG + Intergenic
1038066839 8:23972198-23972220 CAACCATGGACTCCCCACAGGGG + Intergenic
1038155747 8:24988731-24988753 CTTCCTGTTTCTCCCCACACTGG + Intergenic
1038478280 8:27884236-27884258 CATTCAGGCTGTCCCCAAACAGG + Intronic
1039435470 8:37556637-37556659 CCCCCAGGATCACCCCACACTGG + Intergenic
1039877264 8:41597450-41597472 CCTCCAGCCTCTCCCCACACTGG - Intronic
1046168640 8:110474465-110474487 CATCCCGGGTCTACACACATGGG - Intergenic
1049363132 8:142223796-142223818 TATCCATGATCTCCCCACTCTGG - Intronic
1052995094 9:34547714-34547736 CTTCCAGCCTCTCCCCAAACTGG + Intergenic
1058830885 9:108815345-108815367 CATCCCAGGTATCCCAACACAGG + Intergenic
1061360378 9:130138269-130138291 TATCCAGGGTTTCCCCGCCCTGG + Exonic
1061582421 9:131546000-131546022 CTTCCTGGCTCTCCCCACCCTGG - Intergenic
1062033494 9:134372457-134372479 CAACCACTGTCTCCCCTCACGGG - Intronic
1203458710 Un_GL000220v1:13848-13870 CATCCTGGCTTTCCCCACAGGGG - Intergenic
1188981804 X:36733513-36733535 CTTCCAGGTTCTCCCTAGACTGG + Intergenic
1190199196 X:48345565-48345587 CATCAAGGGTCTCACCAACCAGG - Intergenic
1199849547 X:151715622-151715644 CATCCAGAGTCCCCAGACACGGG - Intergenic
1201540638 Y:15101708-15101730 CCTCCAGGGTCTCCTCCCCCAGG - Intergenic
1201963333 Y:19706515-19706537 CATCCAGGGTCACCTCAAGCAGG + Exonic