ID: 1033221899

View in Genome Browser
Species Human (GRCh38)
Location 7:139532464-139532486
Sequence CTAAGCCCAGCTGCCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033221899_1033221903 19 Left 1033221899 7:139532464-139532486 CCCTGGATGGCAGCTGGGCTTAG 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1033221903 7:139532506-139532528 AAGCAGGTCAGAAAGTTCCAAGG No data
1033221899_1033221902 3 Left 1033221899 7:139532464-139532486 CCCTGGATGGCAGCTGGGCTTAG 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83
1033221899_1033221904 20 Left 1033221899 7:139532464-139532486 CCCTGGATGGCAGCTGGGCTTAG 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1033221904 7:139532507-139532529 AGCAGGTCAGAAAGTTCCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033221899 Original CRISPR CTAAGCCCAGCTGCCATCCA GGG (reversed) Intronic
900008537 1:83569-83591 CTAAGCTCTTCTGGCATCCATGG - Intergenic
900036768 1:417652-417674 CTAAGCTCTTCTGGCATCCATGG - Intergenic
900058397 1:653399-653421 CTAAGCTCTTCTGGCATCCATGG - Intergenic
900490989 1:2949074-2949096 TCAGGCCCAGCTGCCCTCCAGGG + Intergenic
900971981 1:5996817-5996839 CTGTGCCCAGCTCCCAGCCATGG - Intronic
902795738 1:18799534-18799556 CTCAGTCCATCTGCAATCCAAGG + Intergenic
903129519 1:21269603-21269625 CAAAGCACAGCTGCCCTCCTTGG - Intronic
903365108 1:22801400-22801422 ATAACACCAGCTGCCACCCAGGG - Intronic
904359807 1:29963964-29963986 CCAAGGCCTGCTGCCCTCCAGGG - Intergenic
907738227 1:57137382-57137404 CTAAGCAGACCTGCCCTCCACGG - Intronic
909733153 1:78921712-78921734 TGAAGACCAGCTGCCATTCATGG + Exonic
916770610 1:167904059-167904081 CTGAGGCCCGCTGCCTTCCAGGG - Intronic
919934421 1:202242064-202242086 CTGAGCCCAGCTGCCTTCCCCGG - Intronic
920003087 1:202812516-202812538 CTCAGCCCAACTGAGATCCAGGG + Intergenic
921512962 1:216054670-216054692 CCACCCCCAGCTGCCAACCAAGG + Intronic
922548952 1:226479815-226479837 CTGAGCACAGCTGTCATCCGAGG + Intergenic
923035808 1:230284438-230284460 CTCAGCCCAGGTGACACCCACGG + Intergenic
1065297842 10:24293540-24293562 CCAAGCCCAACAGCCATCCCTGG - Intronic
1068237941 10:54262944-54262966 TTCAGCCCAGCTGGCAACCATGG - Intronic
1070154186 10:73823610-73823632 TTAAGCCCAGATACCATCCATGG - Intronic
1070791108 10:79190029-79190051 CTCAGCCCAGCTCCCACCCCCGG + Intronic
1071571581 10:86700221-86700243 CCGAGCCCAGCTGCAACCCACGG + Intronic
1072076648 10:91981700-91981722 CAAAGCCAAGCACCCATCCATGG - Exonic
1073084330 10:100878774-100878796 CTATGCCCAGCTGCCAGGAAAGG + Intergenic
1075564639 10:123494573-123494595 CTGAGCCCAGTTTCCACCCAGGG + Intergenic
1076801152 10:132829589-132829611 CTAAGGCCAGCAGCCAGGCAGGG - Intronic
1076856989 10:133122194-133122216 CTGGGCCCAGGTGCCACCCAGGG - Intronic
1077141438 11:1026607-1026629 GTAAGCCCAGCTGCCCACAAAGG - Intronic
1077163743 11:1125850-1125872 GTGAGCCCTGCTGCCAGCCATGG + Intergenic
1077515059 11:2996367-2996389 CAAAGCCGCGGTGCCATCCAAGG - Intergenic
1083296556 11:61718459-61718481 CCCAGCCCAACTGCCACCCACGG + Intronic
1085309731 11:75509082-75509104 CTATGCCCACCAGCCACCCAGGG + Intronic
1085836136 11:79958684-79958706 CTATCCCCACCTGCCATCCCTGG + Intergenic
1086393757 11:86392757-86392779 CAAAGCCCCACTTCCATCCATGG - Exonic
1087130932 11:94668765-94668787 TAAAGCCCAGCTCCCACCCAGGG + Intergenic
1089293408 11:117452117-117452139 CTTACCCCAGTGGCCATCCATGG - Intronic
1089516842 11:119038291-119038313 ATAATCCCAGCTGCCATGCTTGG + Intergenic
1091628375 12:2139892-2139914 CTAAGCACCGAGGCCATCCAGGG + Intronic
1091769557 12:3142185-3142207 CTGGGCCCAGATGCCCTCCAGGG + Intronic
1091923805 12:4327526-4327548 GAAAGCTCAGCTGCCATGCATGG + Intronic
1093750079 12:22788193-22788215 TTGAGCCCAGTTGCCATCCTGGG + Intergenic
1094502930 12:31036642-31036664 CTCTGGCCAGTTGCCATCCAGGG + Intergenic
1097411361 12:59256955-59256977 CAAAGACCACCTGCCATCCCTGG + Intergenic
1099504312 12:83453844-83453866 CTAGGCCCAGCAGCAATCTATGG - Intergenic
1101802142 12:108031770-108031792 CTGAGCCCAGCTGGCATGCTGGG - Intergenic
1102233103 12:111277189-111277211 CTGAACCCAGCTGCCACCCTCGG + Intronic
1104267292 12:127245349-127245371 TTATGTCCAACTGCCATCCATGG + Intergenic
1104761406 12:131299356-131299378 CCAGTCCCAGCTGCCCTCCAGGG + Intergenic
1104818370 12:131661436-131661458 CCAGTCCCAGCTGCCCTCCAGGG - Intergenic
1105898287 13:24736352-24736374 ATAAGGCCAGCTGAGATCCAAGG - Intergenic
1111912977 13:94332270-94332292 CTGAATCCAGCTGCCATCCATGG - Intronic
1112329966 13:98469642-98469664 CTAAATCCAGCTGCAACCCAGGG + Intronic
1113044829 13:106144702-106144724 TTAAGCCGACCTCCCATCCATGG - Intergenic
1113914111 13:113860850-113860872 CTAAGCCCAGCACCCCTCCCAGG - Intronic
1115036806 14:28867727-28867749 CTTAGCCCAGCTGGCATTCTGGG + Intergenic
1115711808 14:36059179-36059201 CTAGACACAGCTGGCATCCAAGG - Intergenic
1117236027 14:53776188-53776210 CTAAGTCCAGATGACTTCCATGG + Intergenic
1121651276 14:95560733-95560755 CTAATCCCTGCTACCATGCAAGG - Intergenic
1122706494 14:103625196-103625218 CTGAGTACAGCTGCCAGCCAGGG + Intronic
1125069944 15:35542412-35542434 CTAAGACCAGCTGAAAACCAAGG - Exonic
1125435855 15:39644807-39644829 CCAAGGCCGGCTGCCATCAAAGG + Intronic
1125521667 15:40351292-40351314 CTAAGCCCTGCTGCCTGGCATGG - Intronic
1126338422 15:47612623-47612645 CTAAGCCCAGATACAATGCAAGG - Intronic
1127905018 15:63370112-63370134 CTAACCCCAGCAGAAATCCATGG + Intronic
1128666344 15:69540808-69540830 CCCAGCCCCGCTGCCAGCCAGGG - Intergenic
1129264896 15:74388191-74388213 CCAACCCCAGCTCCCATCCCGGG - Intergenic
1129654789 15:77516877-77516899 CTAAGGCCAGGTGCCAGGCAGGG + Intergenic
1131225851 15:90623969-90623991 CTAAGCTCAGATGTCCTCCAAGG + Intronic
1132230748 15:100182033-100182055 CTGAGCTCAGCTGACACCCATGG - Intronic
1132445017 15:101908552-101908574 CTAAGCTCTTCTGGCATCCATGG + Intergenic
1132468330 16:88155-88177 GTAAGCCCTGCGGGCATCCAGGG - Intronic
1134244896 16:12532735-12532757 CTGTCCCCAGCTTCCATCCAAGG - Intronic
1135244818 16:20846377-20846399 CTAAGAACAGCTGAAATCCAGGG - Intronic
1135428551 16:22361585-22361607 CTAAGCCCACTTACCAGCCAGGG - Intronic
1136683236 16:31979830-31979852 CTGTGCCCATCTGCCAGCCACGG + Intergenic
1136783870 16:32923386-32923408 CTGTGCCCATCTGCCAGCCACGG + Intergenic
1136885914 16:33930420-33930442 CTGTGCCCATCTGCCAGCCACGG - Intergenic
1139053836 16:63157469-63157491 CTAAACCCATCTGCCCTCCTAGG - Intergenic
1140187565 16:72788438-72788460 CTCAGCCCCGCTGCCCACCATGG - Exonic
1141213156 16:81999724-81999746 CTGAGGCCAGCTGGCATCTATGG - Exonic
1141447277 16:84069251-84069273 GTCAGCCCAGCTGCCCTGCAGGG + Intronic
1141704262 16:85655960-85655982 TTCTGCCCAGCTGCCATCAAGGG - Intronic
1141975884 16:87516167-87516189 GTCAGCCCGGCTGGCATCCAAGG + Intergenic
1142141560 16:88474977-88474999 CTCAGGTCAGCTGCCATTCAGGG - Intronic
1142271885 16:89094077-89094099 TCAAGCCCAGCTGCGACCCAGGG - Intronic
1203086527 16_KI270728v1_random:1187388-1187410 CTGTGCCCATCTGCCAGCCACGG + Intergenic
1143002224 17:3801570-3801592 CTCAGCCCAGCTTCCAGCCCAGG + Intergenic
1144136400 17:12299281-12299303 CTAAGCCAATCTGGCATCCAGGG - Intergenic
1145941855 17:28746913-28746935 CCCAGTCCAGCTGCCATCCTGGG + Intronic
1147144142 17:38475539-38475561 CTGTGCCCATCTGCCAGCCACGG + Intronic
1147584784 17:41647978-41648000 CCAGGCCCAGCCGCCTTCCAAGG + Intergenic
1147644677 17:42026732-42026754 TTAAGGGCAGCTGCCTTCCAAGG - Intronic
1148159595 17:45442332-45442354 CTAACACCAGCTGCCACCCAGGG + Intronic
1150390883 17:64789204-64789226 CTAACACCAGCTGCCACCCAGGG + Intergenic
1150891310 17:69153390-69153412 CAAAGCACAGCTGCAATGCAAGG + Exonic
1151909815 17:77074890-77074912 CTGGGCCCAGCGGCCACCCAGGG + Intergenic
1151972455 17:77465859-77465881 CTCAGCCCAGCCTCCTTCCAGGG - Intronic
1152033360 17:77857167-77857189 CTCAGCCCAGCTGGGACCCAGGG - Intergenic
1152037155 17:77880501-77880523 CTAAGCCCAGCTGGGATCCTCGG - Intergenic
1152420620 17:80190987-80191009 CTGGGACCAGCTGCCATCAAGGG - Intronic
1157375719 18:47162517-47162539 CTAAGAACAGATCCCATCCAGGG + Intronic
1158340934 18:56465510-56465532 CTAAGCTCAGGTGTGATCCAAGG + Intergenic
1158524200 18:58197746-58197768 CTCAGCCCAAATTCCATCCAAGG - Intronic
1160640295 19:125162-125184 CTAAGCTCTTCTGGCATCCATGG - Intergenic
1161471064 19:4457100-4457122 CCAAGCTCAGCTCCCATCCATGG + Intronic
1161513355 19:4683538-4683560 CTGAGCCGAGTTGCCATCCATGG - Exonic
1163685463 19:18709588-18709610 CTCATCCCAACTCCCATCCATGG - Intronic
1165142892 19:33713012-33713034 CGATGCCCAGCTGCTCTCCATGG - Intronic
1167592904 19:50414048-50414070 CAAAGAACAGATGCCATCCAGGG - Intronic
1167736207 19:51295975-51295997 CTGAGCCCAGCAGGCATGCAGGG + Intergenic
1168310599 19:55458183-55458205 CTAAGTCCTGCAGCCATACAGGG + Intronic
926208045 2:10847858-10847880 ATCAGCCCAGGTGCCAGCCAGGG - Intronic
927178999 2:20430724-20430746 GTAAACCCAGCTGCCTTACATGG - Intergenic
927197974 2:20561027-20561049 CTACCCCCAGCTGGCATCCCAGG + Intronic
927309057 2:21607807-21607829 CTCAGCTCAGCTGTCAGCCAGGG + Intergenic
934133094 2:88968579-88968601 CTAAACCCACCTGCCAGTCATGG - Intergenic
934140571 2:89043272-89043294 CTAAACCCACCTGCCAGTCATGG - Intergenic
934146878 2:89103580-89103602 CTAAACCCACCTGCCAGTCATGG - Intergenic
934228059 2:90151175-90151197 CTAAACCCACCTGCCAGTCATGG + Intergenic
934228665 2:90157270-90157292 CTAAACCCACCTGCCAGTCATGG + Intergenic
936754785 2:115694829-115694851 ATAAGCACAGCTGCCTGCCATGG - Intronic
937227973 2:120380586-120380608 TTCAACCCAGCTGCCAGCCATGG - Intergenic
937242416 2:120470823-120470845 CTGAAACCAGCTGCCATCCCAGG - Intergenic
938488830 2:131745743-131745765 CTAGATCCAGCTGCCTTCCATGG + Intronic
940017861 2:149125388-149125410 CTAAGCCCCTCTTCCACCCAGGG + Intronic
942191583 2:173475882-173475904 CTAAGCCCAGCTGCATTCAAGGG - Intergenic
942342584 2:174963606-174963628 CTCAGCCCAGGTTCCCTCCAGGG - Intronic
942939182 2:181597399-181597421 CTAAGAAGAGCTGGCATCCAAGG - Intronic
944595138 2:201254466-201254488 CCAAGGCCAGCTGCCAGTCAAGG + Intronic
944910769 2:204308576-204308598 CTAAGCCAATCTGACAGCCATGG + Intergenic
944928504 2:204491359-204491381 CTAAGACCCTCTGCAATCCATGG - Intergenic
946610199 2:221449578-221449600 CTAAGCCCTCCTGCAGTCCAAGG + Intronic
947463320 2:230321598-230321620 CAATGCCCATCTGCCAACCATGG - Intergenic
948459020 2:238120306-238120328 CTAATCTCGGCTGCCATCCAGGG - Intronic
948788930 2:240367415-240367437 CCTGGCCCAGCTGCCATGCAAGG + Intergenic
1171128603 20:22627274-22627296 ATAAGTCCAGCTCCCATTCAAGG + Intergenic
1172661283 20:36570821-36570843 CTATCCCCAGCTCCCTTCCAGGG + Intergenic
1173006020 20:39140157-39140179 CTAAGCCCAGCAGGCTTCTAAGG - Intergenic
1174517913 20:51107313-51107335 CTCAGCCCTGCTGACATCCGGGG - Intergenic
1174589649 20:51635031-51635053 CTAGGCCCAGCTCCACTCCAGGG - Intronic
1175128042 20:56767044-56767066 CCAAGCCCGGCTGCCAAGCATGG - Intergenic
1175217390 20:57398719-57398741 CCAAGCCCAGCAGCGAGCCAGGG - Intronic
1178588725 21:33891524-33891546 CAAAGCCCAGGTGTCCTCCAGGG + Exonic
1181139736 22:20795808-20795830 CTAGGCCCAGCTACCACCCCTGG + Intronic
1181537405 22:23553697-23553719 CTCTGCCCAGCAGCCCTCCAAGG - Intergenic
1182403690 22:30105316-30105338 CCAGGCCCAGCTGCCATCGCAGG - Intronic
1182476512 22:30579457-30579479 CACAGCCCAGCTGCCATCAGAGG + Intronic
1182982691 22:34686456-34686478 CTAAGCCAAGCTGTCATCTCCGG + Intergenic
1183327324 22:37201466-37201488 CTAATCCCAGCTGCTAGCTAGGG - Intergenic
1183602076 22:38845515-38845537 CCAAGCCCAGCTGCCTGCCCTGG - Intergenic
1185013980 22:48333022-48333044 CATAGCCCAGCGGCCACCCACGG + Intergenic
1185022218 22:48383711-48383733 CTGTGCCCAGCCCCCATCCAGGG - Intergenic
949879810 3:8652405-8652427 CTAATAGCAGCTGCCTTCCATGG + Intronic
949991610 3:9583753-9583775 TTCAGACCAGCTGGCATCCATGG + Intergenic
951092371 3:18589004-18589026 CTAAACCTAGCAACCATCCAAGG - Intergenic
953046462 3:39297686-39297708 CAAAGCCCAGCCGTCATCCCTGG + Intergenic
959667420 3:108937219-108937241 CTCCACCCACCTGCCATCCAGGG + Intronic
961328477 3:126125473-126125495 CTAATGCCAGCTGCCCTCCATGG - Intronic
961444582 3:126973153-126973175 CCATGCACAGCTCCCATCCAGGG - Intergenic
961578234 3:127856001-127856023 CTCAGCCAAGCTACCAACCAAGG + Intergenic
964211833 3:154237111-154237133 CTGAGCCCAGCAGCCATCCTGGG + Intronic
964667800 3:159192917-159192939 CTAAGACCAGCTGCATTGCAGGG - Intronic
968763087 4:2452354-2452376 CCATGCCCAGCTGCCCTGCATGG - Intronic
969472145 4:7395220-7395242 GTCAGCCCAGCTGCCATCTGTGG + Intronic
969712376 4:8851505-8851527 GTAAGCTCTGATGCCATCCAAGG + Intronic
970111805 4:12645920-12645942 CTAATCCAAGTTGCTATCCATGG + Intergenic
975495473 4:75031336-75031358 CTTTGCCCAGCTGCCCTCAAGGG + Intronic
977600585 4:98929925-98929947 CTAAGTCCAGATGCCAGCCAGGG + Intronic
978761329 4:112358249-112358271 CAGAGCCCAGCTGCCCTCCTGGG + Intronic
985267178 4:188161274-188161296 ATAAGTCTAGCTGCCATGCAGGG + Intergenic
996870907 5:128192467-128192489 CTAAGCTCAGCTGCCTTCTATGG - Intergenic
997523055 5:134535518-134535540 CCAGTCCCAGCTGCCACCCAAGG - Intronic
999242019 5:150133252-150133274 CCAAGCCCAACTGCCATCCCAGG - Intronic
999690796 5:154144356-154144378 CTCAGCCCACATGCCATGCATGG + Intronic
1002737053 5:181401210-181401232 CTAAGCTCTTCTGGCATCCATGG + Intergenic
1002747644 6:73569-73591 CTAAGCTCTTCTGGCATCCATGG - Intergenic
1002777377 6:340738-340760 GTAGGGCCAGCTGCCATTCAAGG + Intronic
1003983615 6:11413419-11413441 CTAAGTCCAGCTGCCATTTTTGG + Intergenic
1005982666 6:30848321-30848343 ATAAGCCCAGGTGTGATCCAAGG + Intergenic
1006646737 6:35520108-35520130 CAGTGCCCAGCTGCCACCCAGGG - Intergenic
1006793887 6:36720315-36720337 AGAAGCCCAGATGCCCTCCAGGG - Intronic
1007072294 6:39046630-39046652 CTAAGAGCAGCTGTCAACCATGG - Intergenic
1007946231 6:45829522-45829544 CAGAACCCAGCTGCTATCCATGG - Intergenic
1008281087 6:49597102-49597124 CTAAGCCCTCCTGCCACCTATGG - Intergenic
1008731136 6:54483748-54483770 GAAAGGCAAGCTGCCATCCAGGG - Intergenic
1010464531 6:76151380-76151402 CTCAGCCCCTCTTCCATCCAAGG + Intergenic
1013620134 6:111879923-111879945 CATACCCCAGCTGCCAGCCAGGG + Intergenic
1015364950 6:132386680-132386702 CTAATCCCAGCTCCCACCAAAGG + Intronic
1016311551 6:142738849-142738871 ATTAGCCCAGCTGCCTTCCTGGG - Intergenic
1017485531 6:154898717-154898739 CCATGCCCAGCTGCCCTCGATGG - Intronic
1019118344 6:169783697-169783719 CTCAGCTCTGCTGCCACCCACGG - Intergenic
1019242149 6:170676780-170676802 CTAAGCTCTTCTGACATCCATGG + Intergenic
1019294800 7:268192-268214 CGAATCGCAGCTGTCATCCAGGG + Intergenic
1022388642 7:29924645-29924667 ATGAGCCCAGTTCCCATCCAAGG - Intronic
1026592157 7:71706271-71706293 CTAAGCCATGCAGCCATGCAGGG - Intronic
1027128318 7:75572985-75573007 CTGAGCCCTGTTGCCATGCATGG + Intronic
1028128515 7:87143411-87143433 CTAAGGCCAGCTGACACCCAAGG - Intergenic
1030303263 7:107995295-107995317 CTAAGCCAAGCTGCTCTCAAAGG + Intronic
1031962080 7:127999144-127999166 CTAATCCCAACAGCCATCCTGGG - Intronic
1033221899 7:139532464-139532486 CTAAGCCCAGCTGCCATCCAGGG - Intronic
1034758076 7:153641780-153641802 CTAAGACCCCTTGCCATCCAGGG + Intergenic
1034996470 7:155580356-155580378 CTGGGACCAGCTGCCTTCCAGGG + Intergenic
1035505969 8:131371-131393 CTAAGCTCTTCTGGCATCCATGG - Intergenic
1035559648 8:594850-594872 GGAAGCCCAGCTACCACCCAGGG + Intergenic
1035927385 8:3743053-3743075 CTAAGCACAGCTGCCATACAGGG - Intronic
1036078126 8:5523482-5523504 CCAAACCCAATTGCCATCCATGG + Intergenic
1036662255 8:10715986-10716008 CTAAGCCCAAATGCCAGGCAGGG + Intergenic
1038000120 8:23384262-23384284 CGAAGCACAGCTGACTTCCAAGG + Intronic
1039706795 8:40015635-40015657 CCAGGCCCACCTGCCCTCCATGG - Exonic
1041934884 8:63323520-63323542 CTGAGCCCAGCAGCCATGGAGGG + Intergenic
1048465336 8:134660901-134660923 CCAAGGCCAGGTGCCACCCAGGG - Intronic
1048515268 8:135102489-135102511 CTCAGCGCAGCTGCCATCTGAGG - Intergenic
1049325199 8:142017987-142018009 CCCACCCCAGCTGCCCTCCATGG + Intergenic
1049556627 8:143285608-143285630 CTGAGCCCAGCTCCCATCTGGGG + Intergenic
1053484576 9:38442252-38442274 CTCAGCCGAGCTGGCATCCCTGG - Intergenic
1059358164 9:113717534-113717556 CTAAGCCCAGCTGCCAAACATGG - Intergenic
1059683597 9:116611783-116611805 CTAAGCCCAGATGCCTTCACTGG + Intronic
1060854510 9:126904393-126904415 CTGTGCCCAGCTGCAATTCAAGG + Intergenic
1061272072 9:129549451-129549473 CTCAGCCCAGGTGCCGTCCAGGG + Intergenic
1061308027 9:129743625-129743647 CCCAGCCCTGCTGGCATCCACGG + Intronic
1061669255 9:132179409-132179431 CTAAGCCCATCTGCCAGCTGCGG + Intronic
1062024473 9:134333935-134333957 CAGAGCCCACCTGCCATCCTTGG + Intronic
1062357256 9:136170760-136170782 CTGAGCCCAGGTGCCAGCCAGGG - Intergenic
1203602340 Un_KI270748v1:26002-26024 CTAAGCTCTTCTGACATCCATGG + Intergenic
1186445264 X:9621816-9621838 CTCAGGCCAGCTTCCATCCCTGG - Intronic
1186768885 X:12797989-12798011 CTGTGCACAGCTGCCATCCGGGG - Intronic
1190379160 X:49821824-49821846 CTAAGTCCAGCTCACACCCAAGG - Intergenic
1191670549 X:63744904-63744926 CTAAGCCCTCCTGCCATGCAGGG + Intronic
1194101714 X:89713642-89713664 CTCAGACCAGATGGCATCCAAGG + Intergenic
1198609522 X:138382667-138382689 CAAAGCACTGCTGCCATCAAGGG + Intergenic
1199038373 X:143079975-143079997 CGAAGCCCAACTGCCAACAATGG + Intergenic
1200454662 Y:3374726-3374748 CTCAGACCAGATGGCATCCAAGG + Intergenic