ID: 1033221900

View in Genome Browser
Species Human (GRCh38)
Location 7:139532465-139532487
Sequence TCTAAGCCCAGCTGCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033221900_1033221904 19 Left 1033221900 7:139532465-139532487 CCTGGATGGCAGCTGGGCTTAGA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1033221904 7:139532507-139532529 AGCAGGTCAGAAAGTTCCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 218
1033221900_1033221902 2 Left 1033221900 7:139532465-139532487 CCTGGATGGCAGCTGGGCTTAGA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83
1033221900_1033221903 18 Left 1033221900 7:139532465-139532487 CCTGGATGGCAGCTGGGCTTAGA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1033221903 7:139532506-139532528 AAGCAGGTCAGAAAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033221900 Original CRISPR TCTAAGCCCAGCTGCCATCC AGG (reversed) Intronic
901215908 1:7555327-7555349 TCTGGTCCCAGCTGCCCTCCTGG - Intronic
901282696 1:8051556-8051578 TCTCAGGCCAGATGCCATCCAGG + Intergenic
901814759 1:11787811-11787833 ACTAAGAGCAGCTGCCTTCCTGG + Exonic
902229512 1:15019069-15019091 TCTTATCCCAGCAGCCATACTGG + Intronic
902309618 1:15571933-15571955 TAAGAGCCCAGCTGCCAGCCTGG + Intronic
902625007 1:17671405-17671427 TCTGTCCCCGGCTGCCATCCAGG - Intronic
903756839 1:25668206-25668228 TCTCAGCTCAGCTGTCATCTGGG + Intronic
904401648 1:30260520-30260542 TCCCAGCCCATCTGGCATCCTGG - Intergenic
905266356 1:36756639-36756661 TCTAAGGCCAGCTGCTCTCAGGG - Intergenic
906662747 1:47594047-47594069 TCCAAGCCCCGCTCCCACCCAGG + Intergenic
910105576 1:83628107-83628129 TCTAAAGCCAGCTGCAACCCTGG - Intergenic
912221613 1:107683842-107683864 ACAAAGCCCAGCAGCCATCTTGG + Intronic
912734699 1:112139950-112139972 TTTAATACCAGCTCCCATCCAGG - Intergenic
913711348 1:121486948-121486970 CCTGAGTGCAGCTGCCATCCAGG - Intergenic
914240706 1:145850790-145850812 TGTCACCTCAGCTGCCATCCCGG - Exonic
915060137 1:153174883-153174905 TTAAAGCCCAGCATCCATCCAGG - Intergenic
916324327 1:163540279-163540301 TCTAATCCCAGGTTCCACCCAGG - Intergenic
920370125 1:205473417-205473439 TCTCAGCCCGGCTGGCTTCCAGG - Intergenic
1067118683 10:43455794-43455816 GCTAAGGCCGGCTGCCAGCCTGG - Intronic
1069883208 10:71607011-71607033 GCCCAGCCCAGATGCCATCCAGG + Intronic
1074065111 10:110007333-110007355 TCTCAGCACAGCTGCCTTCGCGG - Intronic
1075564638 10:123494572-123494594 TCTGAGCCCAGTTTCCACCCAGG + Intergenic
1075701095 10:124469924-124469946 TCTTAGCCCAGATGCCTGCCTGG - Intronic
1076253933 10:129005116-129005138 TCTGAGCCCAGCTGTCTCCCAGG + Intergenic
1076481534 10:130788252-130788274 TCTGAGCCCAGGTGCCTTCTTGG + Intergenic
1077370540 11:2179729-2179751 TCTGAGCCCAGCTGCCCCCAGGG - Intergenic
1080689767 11:34546589-34546611 TCCAAGCCCAGCGACCAACCAGG - Intergenic
1084639765 11:70418212-70418234 TACAAGCCAAGCTGCCCTCCAGG - Intronic
1090447786 11:126779011-126779033 TCTAAGCACAGCAGCAATTCTGG - Intronic
1091284939 11:134403279-134403301 TCTCATCCCTGCTGCCTTCCCGG - Intronic
1092777833 12:11959587-11959609 TCAAAGCCCAGCTCCACTCCTGG + Intergenic
1093750078 12:22788192-22788214 CTTGAGCCCAGTTGCCATCCTGG + Intergenic
1095190846 12:39256396-39256418 TCTAAGCCCAGATCCCTTCCAGG - Intergenic
1096707174 12:53429601-53429623 ACAAGGCCCAGCTGCCATCATGG + Exonic
1101802143 12:108031771-108031793 GCTGAGCCCAGCTGGCATGCTGG - Intergenic
1103119835 12:118371986-118372008 TCTCAGCCCAGCCCCCTTCCGGG + Intronic
1104115362 12:125744526-125744548 TCCCAGCCCCGCTGCCCTCCAGG - Intergenic
1104881604 12:132075185-132075207 GCTACTGCCAGCTGCCATCCTGG - Intronic
1104983718 12:132585349-132585371 TCCCAGCCCTGCTGCCACCCCGG + Intergenic
1105510662 13:21049304-21049326 TCTAAGCCCACCTTCCACTCAGG - Intronic
1109452847 13:62540814-62540836 TCTATTCCCACCTGCCCTCCTGG + Intergenic
1110438245 13:75498761-75498783 TCTATTCACAGGTGCCATCCTGG - Intergenic
1115036805 14:28867726-28867748 GCTTAGCCCAGCTGGCATTCTGG + Intergenic
1117127846 14:52650441-52650463 TCTATGACCAGATGACATCCAGG + Intronic
1117959931 14:61152928-61152950 TCTCAGTCCTGCTGCCATGCTGG + Intergenic
1118310169 14:64686130-64686152 TCCAGGCCCAGCTGCACTCCAGG + Intergenic
1119195070 14:72711785-72711807 TCGAAGCACAGCTGGCATCATGG + Intronic
1119389824 14:74283596-74283618 TCAGAGTCCAGCTGCCGTCCAGG + Intergenic
1119752136 14:77086868-77086890 TCTCATCCCAGCTGGCATCACGG - Intergenic
1121026297 14:90618824-90618846 TATGAGCCCAGCTTCCTTCCTGG + Intronic
1121331015 14:93049841-93049863 TCCCACCCCAGCTGCCAGCCCGG - Intronic
1122372192 14:101234876-101234898 TCTGAGCCCAGCTCCCAGCTAGG + Intergenic
1122826486 14:104373294-104373316 TCTGCGCCCAGCAGCCCTCCTGG + Intergenic
1124032212 15:26021843-26021865 TCTAAGCCGAGTTGGCACCCTGG - Intergenic
1125602392 15:40922850-40922872 TCTGATCCCAGCTGCCACCCAGG - Intergenic
1125932992 15:43613215-43613237 TCGCAGCCTGGCTGCCATCCGGG - Exonic
1125946091 15:43712677-43712699 TCGCAGCCTGGCTGCCATCCGGG - Intergenic
1128666346 15:69540809-69540831 TCCCAGCCCCGCTGCCAGCCAGG - Intergenic
1128893394 15:71351058-71351080 TCTAAGGCCAGCTGTGGTCCTGG + Intronic
1129264898 15:74388192-74388214 GCCAACCCCAGCTCCCATCCCGG - Intergenic
1131735989 15:95332942-95332964 TCTGGGCACAGCTGTCATCCTGG + Intergenic
1132468331 16:88156-88178 TGTAAGCCCTGCGGGCATCCAGG - Intronic
1135244819 16:20846378-20846400 TCTAAGAACAGCTGAAATCCAGG - Intronic
1137445741 16:48531083-48531105 TCTAGGCCCAGTTGCCATTCTGG - Intergenic
1138055666 16:53830608-53830630 TCCGCGCCCAGCTGCCTTCCTGG - Intronic
1138556412 16:57773530-57773552 TATAATCCCAGCTGTAATCCGGG + Intronic
1140310226 16:73841434-73841456 TCCAAGCCCAGGTGTCTTCCTGG - Intergenic
1140731913 16:77864090-77864112 TGGAAACCCAGCTGCCATCATGG + Intronic
1141611144 16:85181816-85181838 CCTACCCTCAGCTGCCATCCAGG - Intronic
1141704263 16:85655961-85655983 TTTCTGCCCAGCTGCCATCAAGG - Intronic
1141998707 16:87651155-87651177 TGTAAGCCGTGCAGCCATCCAGG - Intronic
1142144013 16:88485182-88485204 TGTAGGCCCAGCGTCCATCCAGG - Intronic
1142663680 17:1449047-1449069 GCTTGGCCCAGCTGCCAGCCTGG + Intronic
1143082898 17:4394635-4394657 GCTAAGCCTAGCCCCCATCCAGG + Intergenic
1144136401 17:12299282-12299304 TCTAAGCCAATCTGGCATCCAGG - Intergenic
1145941853 17:28746912-28746934 TCCCAGTCCAGCTGCCATCCTGG + Intronic
1146072783 17:29699585-29699607 TCTACACTCAGCTGCCACCCAGG - Intronic
1146916746 17:36682819-36682841 TCTAAGTCCACCCACCATCCAGG - Intergenic
1147501335 17:40966747-40966769 TCTAACAACGGCTGCCATCCTGG - Exonic
1147911755 17:43860176-43860198 CCTATACCCTGCTGCCATCCGGG - Intronic
1147971319 17:44220121-44220143 TCCGAGCCCCGCCGCCATCCGGG - Intronic
1148159594 17:45442331-45442353 ACTAACACCAGCTGCCACCCAGG + Intronic
1150390882 17:64789203-64789225 ACTAACACCAGCTGCCACCCAGG + Intergenic
1150564825 17:66329386-66329408 CCTAAATCCAGCTGCCTTCCCGG - Intronic
1150666135 17:67140180-67140202 TGTAATCCATGCTGCCATCCAGG - Intronic
1151078524 17:71301699-71301721 TCCCAGCCCAGGTGCCAGCCAGG + Intergenic
1151909814 17:77074889-77074911 TCTGGGCCCAGCGGCCACCCAGG + Intergenic
1152420621 17:80190988-80191010 TCTGGGACCAGCTGCCATCAAGG - Intronic
1155333969 18:24746220-24746242 GCTCAGCCCAGCTCGCATCCTGG - Intergenic
1156183966 18:34639849-34639871 TGCAAGCTCAGCTGCCAGCCTGG + Intronic
1156450869 18:37265936-37265958 CCTAAGCCGAGCTGTCAGCCAGG - Intronic
1158102864 18:53850260-53850282 ACCAATCCCAGCTGCTATCCTGG + Intergenic
1160961151 19:1721497-1721519 TCTATGCCCTTGTGCCATCCTGG - Intergenic
1161235773 19:3197289-3197311 TCAAAGCCCAGCTGCCAAGAGGG - Intronic
1161752103 19:6105604-6105626 TCTCAGCCCAGCAGCCAGACGGG - Intronic
1162018768 19:7859328-7859350 TGTAGGTCCCGCTGCCATCCTGG + Intronic
1162779038 19:12997020-12997042 GCTTAGCCCTGCTGCCAGCCAGG + Intronic
1164530272 19:29043199-29043221 TCAAATCCCAGCTTCCTTCCAGG + Intergenic
1165141043 19:33700085-33700107 TCTAAGCCCAGACTCCTTCCTGG + Intronic
1165346303 19:35250507-35250529 TCAATGCCCAGCTGGCAGCCGGG + Exonic
1167592905 19:50414049-50414071 TCAAAGAACAGATGCCATCCAGG - Intronic
1168643992 19:58048044-58048066 TCTGAGCGCAGCTGCTTTCCTGG - Intronic
925051907 2:821938-821960 TCAGACCCCAGCTTCCATCCCGG + Intergenic
928263061 2:29785169-29785191 TCTAAGCACTGCTGATATCCTGG + Intronic
936252725 2:110879294-110879316 TCTCAGTCCAGCTGCTGTCCTGG - Intronic
937905602 2:127051352-127051374 TCTAGACCCTGCTGCCAGCCAGG - Intronic
940017860 2:149125387-149125409 TCTAAGCCCCTCTTCCACCCAGG + Intronic
940707626 2:157125079-157125101 TCTAGGCACAGCTGCCACTCAGG + Intergenic
942191584 2:173475883-173475905 GCTAAGCCCAGCTGCATTCAAGG - Intergenic
942668929 2:178352743-178352765 TCAAAGCTCAGATGCCATGCTGG - Intronic
944490483 2:200253620-200253642 TGAAAGCCCTGCTGCCTTCCTGG + Intergenic
944557431 2:200901748-200901770 TCTTTCCCAAGCTGCCATCCTGG + Intronic
946061285 2:216943660-216943682 TCTAGGCACAGCTGCCATCATGG + Intergenic
947719662 2:232362834-232362856 TGAGAGCACAGCTGCCATCCTGG - Intergenic
948459021 2:238120307-238120329 GCTAATCTCGGCTGCCATCCAGG - Intronic
948932084 2:241138360-241138382 TCTAATGCCAGCTACTATCCTGG + Intronic
1172661282 20:36570820-36570842 TCTATCCCCAGCTCCCTTCCAGG + Intergenic
1172813796 20:37670638-37670660 TCTAAGCCCTGCTGGCTGCCTGG - Intergenic
1173012034 20:39191417-39191439 TCCAGGCCCAGCTGCCAAGCTGG + Intergenic
1174517914 20:51107314-51107336 CCTCAGCCCTGCTGACATCCGGG - Intergenic
1175933930 20:62506422-62506444 TTCAAGTCCACCTGCCATCCTGG - Intergenic
1176139678 20:63539525-63539547 TCTGGGCACAGCTGCCAACCTGG + Intergenic
1178502314 21:33135859-33135881 TCTATGCCCAGAAACCATCCTGG + Intergenic
1180204213 21:46247476-46247498 TGTAATCCCAGCTACTATCCAGG - Intronic
1180935602 22:19623166-19623188 TCTCTGCCCAGCTGGCATGCTGG + Intergenic
1183327325 22:37201467-37201489 TCTAATCCCAGCTGCTAGCTAGG - Intergenic
1183381998 22:37494907-37494929 ACGAAGCCCAGCCACCATCCAGG + Intronic
1183589927 22:38774125-38774147 CCTGAGGCCAGCTCCCATCCTGG + Intronic
1184834408 22:47012576-47012598 TCTAAGCCCTGCTGCCTTCCCGG + Intronic
950432728 3:12960270-12960292 TCTTAGCCCAGATGACTTCCTGG + Intronic
954204822 3:49050805-49050827 CCTGAGCTCAGCTGCCCTCCTGG - Intronic
954611615 3:51947351-51947373 CCTAAGCCCCTCTGCCCTCCTGG - Intronic
955967738 3:64406508-64406530 TCCAAGCCCAGCTTCAATCACGG + Intronic
956046430 3:65200679-65200701 TCAAAGCCAAGCTTGCATCCCGG - Intergenic
956348222 3:68304485-68304507 TCTATGCCCACCTCCCATCTTGG + Intronic
959667419 3:108937218-108937240 TCTCCACCCACCTGCCATCCAGG + Intronic
960632128 3:119742868-119742890 TCTATGCTCAGCTTCCTTCCTGG - Intronic
961050425 3:123740882-123740904 GCTAACCCCAGCTGCCTTGCTGG - Intronic
961444584 3:126973154-126973176 TCCATGCACAGCTCCCATCCAGG - Intergenic
964211832 3:154237110-154237132 ACTGAGCCCAGCAGCCATCCTGG + Intronic
966340763 3:178923366-178923388 TCTCAGCAAAGCAGCCATCCAGG + Intergenic
966988160 3:185201277-185201299 CCCAAACCCTGCTGCCATCCTGG - Intronic
968584427 4:1409536-1409558 TCTCTGCCCATCTGCCATCTCGG + Intergenic
968617435 4:1584580-1584602 TCTAGCCCCAGCTGACATCCAGG - Intergenic
968890189 4:3364684-3364706 TCTAAGTCCAGGTGTCAGCCCGG - Intronic
968920940 4:3522072-3522094 TCTAAGGCCAGGAGGCATCCAGG - Intronic
969219391 4:5749736-5749758 TCTGAGCCGAGCTGCCACACGGG - Intronic
969846845 4:9926059-9926081 TGTTAGCACAGGTGCCATCCTGG + Intronic
971413501 4:26400413-26400435 TCTCAGCACTGCTGACATCCTGG - Intronic
971846460 4:31924790-31924812 TCGAATCCCAGATTCCATCCAGG + Intergenic
971862209 4:32122402-32122424 TCTATGCCCAGCCGCAAGCCAGG - Intergenic
972492389 4:39600130-39600152 TCTTAGCCCAGCTGGCATTGGGG + Intronic
973706942 4:53590432-53590454 TTTAAGCCCAGCTGCCTGCTGGG - Intronic
977600584 4:98929924-98929946 CCTAAGTCCAGATGCCAGCCAGG + Intronic
978761328 4:112358248-112358270 CCAGAGCCCAGCTGCCCTCCTGG + Intronic
985727196 5:1522836-1522858 TGTAAGCCCAGCTGGCAGCCAGG + Intronic
990175124 5:53099398-53099420 TCTAAGATCAGCTGCAAGCCTGG - Intronic
992776149 5:80090957-80090979 GCTGAGCCCAGTTCCCATCCTGG + Intergenic
993722288 5:91333560-91333582 TCTAATCCCTGCTTCCATCATGG - Intergenic
998785484 5:145704226-145704248 TCTAAGCACAGCAGTCAACCAGG + Intronic
999245557 5:150152639-150152661 TCTGAGACCAGCTGCCTTCTAGG - Intronic
1007833068 6:44653660-44653682 GCTCAGCTCACCTGCCATCCAGG + Intergenic
1013465110 6:110411082-110411104 TCAAATGCCAGCTGGCATCCGGG + Intronic
1014897190 6:126916516-126916538 TTTAAGCCCAGATGCCATTTAGG - Intergenic
1015793138 6:136983900-136983922 TCTGGGCCCAGGTCCCATCCTGG - Intergenic
1016311552 6:142738850-142738872 CATTAGCCCAGCTGCCTTCCTGG - Intergenic
1022560605 7:31345446-31345468 TGAAAGCCCAGATGCCATCTAGG - Intergenic
1026849230 7:73714687-73714709 CCCAAGCCCAGCTAACATCCTGG + Intronic
1029104413 7:98163730-98163752 ACTGAGCCCAGCTCCCAGCCTGG + Intronic
1030587140 7:111434673-111434695 TGTAATCCCAGCTGTAATCCTGG - Intronic
1031030489 7:116728899-116728921 TCTAAGTCTAGGTGACATCCTGG - Intronic
1031962081 7:127999145-127999167 CCTAATCCCAACAGCCATCCTGG - Intronic
1033221900 7:139532465-139532487 TCTAAGCCCAGCTGCCATCCAGG - Intronic
1034344522 7:150378446-150378468 TCTCCGCCCAGTTGCCACCCCGG - Intronic
1035927386 8:3743054-3743076 GCTAAGCACAGCTGCCATACAGG - Intronic
1036662254 8:10715985-10716007 TCTAAGCCCAAATGCCAGGCAGG + Intergenic
1037451928 8:19024329-19024351 TCTAAGCCCTGCTGTCCTCTTGG - Intronic
1038027810 8:23607856-23607878 TCACAGCCCAGCAGCAATCCTGG - Intergenic
1038664927 8:29529729-29529751 TCACAGCCCAGATGCCATCTCGG - Intergenic
1041931766 8:63295106-63295128 TCCTACCCCACCTGCCATCCAGG + Intergenic
1044674238 8:94713610-94713632 TCTCAGCCAAGGTGCCATCCAGG + Intergenic
1049474011 8:142788545-142788567 TCTCAGGCCACCTGACATCCCGG - Intergenic
1049556626 8:143285607-143285629 CCTGAGCCCAGCTCCCATCTGGG + Intergenic
1049646249 8:143737107-143737129 TCTGAGGCCAGCCGCCCTCCTGG + Intergenic
1050057391 9:1670016-1670038 TCATATCCCAGCTGCCATGCTGG - Intergenic
1052854327 9:33397743-33397765 TCCAACCCCAGCTCCCATGCTGG + Intronic
1056947036 9:91006304-91006326 TCAGACCCCAGCTGCCAACCAGG + Intergenic
1057354451 9:94322358-94322380 TGTAAGCCCACCCTCCATCCCGG + Intronic
1057653310 9:96935277-96935299 TGTAAGCCCACCCTCCATCCCGG - Intronic
1060109319 9:120895065-120895087 TCTGAGCCCAACTGTCATCTTGG - Intergenic
1060683212 9:125584210-125584232 TCTAAGCCTAGGTGGCATCTTGG + Intronic
1060790026 9:126479690-126479712 TCTAAGTCCAGCAGCCACACTGG + Intronic
1061272071 9:129549450-129549472 GCTCAGCCCAGGTGCCGTCCAGG + Intergenic
1061517465 9:131098001-131098023 TCTAAGCCCAGCTGACAGTCTGG + Intronic
1062357257 9:136170761-136170783 CCTGAGCCCAGGTGCCAGCCAGG - Intergenic
1062597411 9:137305512-137305534 TCTCTGCCCAGTTCCCATCCTGG - Intergenic
1185505352 X:629660-629682 TCACAGCTCAGCTGTCATCCTGG + Intronic
1186768886 X:12797990-12798012 CCTGTGCACAGCTGCCATCCGGG - Intronic
1187439458 X:19305006-19305028 TCCAAGCCCAGCTCCCTGCCAGG - Intergenic
1189241965 X:39532234-39532256 TCTGAGACCAGCTGGCTTCCTGG + Intergenic
1190039525 X:47058609-47058631 TCCCAGACCAGCTGCCCTCCAGG - Exonic
1190281490 X:48934019-48934041 TATCAGCCAAGCTGCCAGCCTGG + Intronic
1190808790 X:53864128-53864150 TCTAGCCCCTGCTGACATCCAGG + Intergenic
1191670548 X:63744903-63744925 TCTAAGCCCTCCTGCCATGCAGG + Intronic
1195382248 X:104281950-104281972 GCCAAGCCCAGCTGCCACCCTGG + Intergenic
1195704682 X:107730323-107730345 TCCAGGCCCAGCTGCACTCCAGG + Intronic
1196988065 X:121296502-121296524 TAAAAGCCCAGGTGCCATCTTGG + Intergenic
1197728508 X:129792197-129792219 CCAGAGCCCAGCTGCCTTCCCGG + Intronic
1197829824 X:130629771-130629793 GATAATCCCAGCTGCCATCTAGG - Intronic
1198462965 X:136880779-136880801 TCTAAGCTCCGTTTCCATCCGGG - Intergenic