ID: 1033221902

View in Genome Browser
Species Human (GRCh38)
Location 7:139532490-139532512
Sequence GCAACTAGTCAGATTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033221895_1033221902 17 Left 1033221895 7:139532450-139532472 CCGGTGTGGGGAGACCCTGGATG 0: 1
1: 0
2: 3
3: 16
4: 162
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83
1033221899_1033221902 3 Left 1033221899 7:139532464-139532486 CCCTGGATGGCAGCTGGGCTTAG 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83
1033221893_1033221902 27 Left 1033221893 7:139532440-139532462 CCTCAGGCTGCCGGTGTGGGGAG 0: 1
1: 0
2: 3
3: 21
4: 287
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83
1033221900_1033221902 2 Left 1033221900 7:139532465-139532487 CCTGGATGGCAGCTGGGCTTAGA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033221902 Original CRISPR GCAACTAGTCAGATTCAAGC AGG Intronic
902564099 1:17298817-17298839 GCAAAAAATCAGAATCAAGCTGG + Intergenic
906844607 1:49178114-49178136 GGAGCTAGGCAGATTTAAGCTGG + Intronic
909564270 1:77037626-77037648 GCAAATAGTAAGATCTAAGCAGG + Intronic
910850682 1:91647195-91647217 TCAGCTAGTCTGATTGAAGCAGG - Intergenic
911866950 1:103039472-103039494 GAGACCAGTCAGATTCAATCAGG - Intronic
919814386 1:201428438-201428460 GAAACTAATCATTTTCAAGCTGG + Intronic
923661171 1:235958594-235958616 GTAGCTAGTCAGACACAAGCAGG - Intergenic
923958811 1:239054010-239054032 GGATCTAGTCAGATGCAAGAAGG + Intergenic
1065810002 10:29433305-29433327 GCAACAAAACTGATTCAAGCAGG - Intergenic
1070164644 10:73888480-73888502 GCAACTTGTCAGAATAAAGGAGG - Intergenic
1076191461 10:128486279-128486301 GCAACAAGACAAAGTCAAGCAGG - Intergenic
1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG + Intergenic
1086337909 11:85817588-85817610 GTACCCAGTCAGCTTCAAGCAGG - Intergenic
1086855223 11:91858117-91858139 GCAGCGAATCAGATTCATGCAGG - Intergenic
1087359122 11:97135913-97135935 GTAACTAAAAAGATTCAAGCAGG - Intergenic
1095707324 12:45251430-45251452 GCAAACAGTCTGATTCAAGATGG + Intronic
1095864809 12:46959748-46959770 GCAGCTTGTGAAATTCAAGCAGG + Intergenic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1101764349 12:107684336-107684358 ACAACTACCCAGATTCAAGTTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1110275306 13:73635602-73635624 GCAACTAGTCAGACATGAGCAGG + Intergenic
1118488248 14:66234215-66234237 TCAGCTAAGCAGATTCAAGCTGG - Intergenic
1123220581 14:106851642-106851664 GCAACTATGCAAATTCAAGTGGG - Intergenic
1127332467 15:57952330-57952352 GCAACTAGTCAGACTACAGAGGG - Intergenic
1129090859 15:73148927-73148949 GGAACTACTCAGATGGAAGCAGG + Intronic
1133679744 16:8109729-8109751 GCAACTAGACATGTTCAAGATGG - Intergenic
1134765232 16:16751617-16751639 GCAACTTGTCACATTCAATAAGG - Intergenic
1134980822 16:18607594-18607616 GCAACTTGTCACATTCAATAAGG + Intergenic
1148894327 17:50831265-50831287 GTGATTAGTCAGACTCAAGCCGG - Intergenic
1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG + Intergenic
1153895161 18:9551971-9551993 CCATCTAGTCAGGGTCAAGCTGG - Intronic
1157107610 18:44789434-44789456 GAAAGAAGTCAGATTCAAGAGGG - Intronic
1159216090 18:65392600-65392622 ACAACATGTCAGTTTCAAGCTGG - Intergenic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG + Intronic
925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG + Intronic
926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG + Intergenic
932448895 2:71797209-71797231 ACAAACAGTCAGAATCAAGCCGG - Intergenic
933423477 2:82081814-82081836 GCTATTAGTCTGATGCAAGCAGG + Intergenic
935587346 2:104813558-104813580 GCAACAACTGAAATTCAAGCTGG - Intergenic
939042704 2:137209917-137209939 GATACCAGTCAGATTCAAACAGG - Intronic
939392445 2:141585962-141585984 GCAACTTGGCAGACTGAAGCAGG - Intronic
1177482872 21:21714810-21714832 GTAACTAGTGAGATTCAGGAAGG + Intergenic
1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG + Intronic
1183824693 22:40376398-40376420 GCAACTCATGAGATTAAAGCAGG - Intronic
951483754 3:23189305-23189327 GCAACTAGACTCATTCCAGCAGG + Intergenic
952599823 3:35066714-35066736 GCAAATTTTCAGATTGAAGCTGG + Intergenic
953346925 3:42183808-42183830 GCTACCAGTCAGATTCAACTTGG - Intronic
960692702 3:120363564-120363586 GGAGTTACTCAGATTCAAGCAGG + Intergenic
963686006 3:148434770-148434792 GCAAATAGACAGCTTCAAGAAGG - Intergenic
964203495 3:154144744-154144766 GCAAGTACTCAGCCTCAAGCAGG - Intronic
969199614 4:5592435-5592457 GTAACTAGTCAGATGTGAGCAGG + Intronic
985608427 5:871938-871960 GCAACTGGTCATATTCCAGGTGG - Intronic
987175011 5:15298705-15298727 TCAACTATTAAGATTCAAACAGG + Intergenic
993423944 5:87738705-87738727 GGAAAAAGTCAGATTCAAGTAGG + Intergenic
994271957 5:97788252-97788274 GAAATTATTCAGATTTAAGCAGG - Intergenic
994501883 5:100589374-100589396 GCACCTCATCAGATTCTAGCTGG + Intergenic
999231066 5:150062029-150062051 ACAACAAGGCAGAGTCAAGCAGG - Intronic
1004495305 6:16157243-16157265 GCAAGTAGTGAGATTTAAGCTGG - Intergenic
1005303625 6:24494140-24494162 GCCACTAGTAAGATTAAAGTTGG - Intronic
1006790098 6:36694619-36694641 GAAACTAGTCAGATTTGGGCTGG - Intergenic
1012669490 6:102024207-102024229 GTGACTTGTCAGTTTCAAGCTGG + Intronic
1014240592 6:119014069-119014091 GCAACTAGTAAGACTCAGTCAGG - Intronic
1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG + Intronic
1022214376 7:28243688-28243710 GACACTAGTCAGATTAAAACAGG - Intergenic
1026111303 7:67460816-67460838 ACAACTGGTCAGTTTCAGGCAGG - Intergenic
1028664154 7:93320857-93320879 GTAACTACTTAGAATCAAGCTGG - Intronic
1033064990 7:138145947-138145969 GCAACTAGACAGTTTCATCCGGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034544283 7:151779660-151779682 GCTCCTAGTCAGAGGCAAGCAGG - Intronic
1036095006 8:5714076-5714098 GTAGCTAGTCAGATATAAGCAGG - Intergenic
1041352513 8:56962188-56962210 GCAACTGGTCAAATTCGAGAAGG - Exonic
1043837326 8:85062729-85062751 GAAACCAGTCAGAATCAAGATGG - Intergenic
1044697602 8:94938479-94938501 GCAACTAGGCAGCTTCAGGATGG + Intronic
1046504372 8:115117911-115117933 GCAACCAGTCATATTCAAAGAGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1050186461 9:2980239-2980261 GCAGTAAGTCAGTTTCAAGCAGG + Intergenic
1051041313 9:12815642-12815664 TCAACTAGTCAGATAAAAGCAGG - Intronic
1055306004 9:74929722-74929744 GCAACTAGACAGAATTGAGCAGG + Intergenic
1059531486 9:115039538-115039560 GGAAATGGTCAGATTCATGCTGG - Intronic
1185513743 X:682773-682795 GCAACTTCTGAGATGCAAGCAGG + Intergenic
1189705611 X:43756119-43756141 GCAAAAAGTCATATTCAACCAGG - Intergenic
1193394555 X:80968356-80968378 GGAACTAGCCAGATGCCAGCCGG - Intergenic
1194735547 X:97508854-97508876 AGAAATAGTTAGATTCAAGCTGG - Intronic
1198632995 X:138662996-138663018 GGAACTAGTCTTGTTCAAGCTGG - Intronic
1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG + Intergenic