ID: 1033222300

View in Genome Browser
Species Human (GRCh38)
Location 7:139536216-139536238
Sequence CAGTGGGACTGGCGGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033222283_1033222300 14 Left 1033222283 7:139536179-139536201 CCTCCCCCTGTTTCTCATTAGCA 0: 1
1: 0
2: 1
3: 16
4: 225
Right 1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG 0: 1
1: 0
2: 1
3: 35
4: 437
1033222285_1033222300 11 Left 1033222285 7:139536182-139536204 CCCCCTGTTTCTCATTAGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG 0: 1
1: 0
2: 1
3: 35
4: 437
1033222289_1033222300 8 Left 1033222289 7:139536185-139536207 CCTGTTTCTCATTAGCAGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG 0: 1
1: 0
2: 1
3: 35
4: 437
1033222287_1033222300 10 Left 1033222287 7:139536183-139536205 CCCCTGTTTCTCATTAGCAGGGT 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG 0: 1
1: 0
2: 1
3: 35
4: 437
1033222288_1033222300 9 Left 1033222288 7:139536184-139536206 CCCTGTTTCTCATTAGCAGGGTA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG 0: 1
1: 0
2: 1
3: 35
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033222300 Original CRISPR CAGTGGGACTGGCGGTGGGA TGG Intronic
900201042 1:1406709-1406731 CAGTGGGGGTGGCGGCGGGGCGG + Intronic
900357198 1:2270679-2270701 CAGAGGGGCTGGAGGTGGGGCGG + Intronic
900404872 1:2488283-2488305 CCCTGGGACTGTAGGTGGGAAGG + Intronic
900460345 1:2799678-2799700 CAGGGCGACTGTCGGAGGGAAGG - Intronic
900735818 1:4298762-4298784 GAGTGGGACTGGGGAGGGGATGG + Intergenic
901517549 1:9759098-9759120 CAGTGGGACTTGCTGTGCCAAGG - Intronic
901813766 1:11782336-11782358 GGGTGGGCCTGGGGGTGGGAGGG + Intronic
902354383 1:15886508-15886530 GACTGGGCCAGGCGGTGGGAGGG + Intronic
903170390 1:21548763-21548785 CTGTGGGAATGGCAGTGGGGAGG - Intronic
903222708 1:21878004-21878026 CAGGTGGCCTGGCGTTGGGAAGG - Intronic
903859757 1:26357475-26357497 CAGGGGGACTGGGGGTGTGGTGG - Intergenic
904593004 1:31625660-31625682 GAGTGGGAGTGGGGGTGGCAGGG - Intronic
904670161 1:32158665-32158687 GTGGGGGACTGGGGGTGGGATGG - Intronic
905284407 1:36869877-36869899 GAATGGGACTGGCAGTGGGTTGG + Intronic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
905798361 1:40828136-40828158 CAGTGAGAGTGGCCCTGGGAGGG + Intronic
905809615 1:40902520-40902542 CAGTGGGGCTGGTTCTGGGAAGG + Intergenic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906208375 1:43998963-43998985 CAGAGGGCCTGGCGGGGGAAGGG + Intronic
907241716 1:53084656-53084678 CCGTGGGACACGCCGTGGGAAGG - Exonic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907307948 1:53523946-53523968 CAGAGTGACTGGCGCTGAGAGGG - Intronic
907349170 1:53811719-53811741 GAGAGGGACTGGCAGTGGGTGGG - Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
907735194 1:57105251-57105273 CACTGGGATTGGGGGTGGGGTGG + Intronic
907814170 1:57901819-57901841 CAGTGGGGTTGGCTGTGAGAAGG - Intronic
907964951 1:59319860-59319882 CAGAGGGACTGCTGGGGGGAAGG + Intronic
908028306 1:59973594-59973616 CAGTGGGAGTGGGGGTGTTAAGG - Intergenic
909878633 1:80844701-80844723 CAGTGGGACCTGCTGGGGGAGGG - Intergenic
910598491 1:89005375-89005397 GAGAGGGACTGGTGGTGGGCAGG + Intergenic
912255330 1:108052645-108052667 CAGTGGGACTGGGCATAGGAAGG + Intergenic
913194530 1:116444670-116444692 CAGTGGGGCTGGGGCTGGGCTGG - Intergenic
913274129 1:117121553-117121575 CAGTGGGGCGGGCGGCGGGAGGG - Exonic
913506338 1:119519289-119519311 CAGAGTGACTGCCTGTGGGACGG - Intergenic
914679007 1:149926002-149926024 AGGTGGCACTGGGGGTGGGAAGG + Exonic
915547429 1:156608972-156608994 CAGTGGGAGTAGAGCTGGGAAGG + Intergenic
915937644 1:160098621-160098643 CAGCGGGAGGGGCGGAGGGAGGG - Exonic
917057856 1:171003769-171003791 GAGAGGGACTGGTGGTGGGTAGG + Intronic
917713386 1:177710007-177710029 CAGTGGGACAGGGAGTGGGCTGG - Intergenic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
921054025 1:211530738-211530760 GAGGGGCACTGGGGGTGGGAGGG - Intergenic
922078149 1:222268285-222268307 CAGTGGTAGTGGTTGTGGGATGG - Intergenic
922616007 1:226961565-226961587 AAGGGGGCCTGGCAGTGGGAGGG + Intronic
923978957 1:239298413-239298435 CAGGGGGACTGGAGTGGGGAGGG - Intergenic
1062868985 10:882093-882115 AAGTGGGCCTGGGGGTGGGCTGG + Intronic
1062953787 10:1526555-1526577 TGGTGGGAGAGGCGGTGGGAGGG - Intronic
1063551604 10:7039208-7039230 CAGTGGGACAGATGGTAGGAAGG - Intergenic
1063663469 10:8048891-8048913 AGGTGGTAGTGGCGGTGGGAGGG + Intergenic
1066153381 10:32649152-32649174 CTGTGGGAGTTGTGGTGGGAGGG + Intronic
1067018318 10:42773744-42773766 CAGAGGGCCTGTGGGTGGGATGG - Intergenic
1068522195 10:58089826-58089848 CAGTTGGTCTGGCTGTGTGACGG + Intergenic
1069635079 10:69920092-69920114 CAGAGGCCCTGGCAGTGGGAGGG - Intronic
1069654570 10:70078336-70078358 CACTGGGACTGGCCGGGGGCAGG - Intronic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070712931 10:78696674-78696696 CAATGGGGCGGGGGGTGGGAAGG + Intergenic
1074453870 10:113580814-113580836 CAGTTGGGCTGGCACTGGGATGG - Intronic
1075241184 10:120780549-120780571 CAGTGGGAGAGGCAGTCGGAGGG - Intergenic
1075551059 10:123392536-123392558 CAGTAGGAGTGGTGGTGGGGTGG + Intergenic
1076381265 10:130025979-130026001 CAGTGGGATTTGCGGTTGAAAGG + Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077178008 11:1199317-1199339 CAGAGGGACAGACGGAGGGAGGG + Intronic
1077315892 11:1919221-1919243 CATTGGGCCGGGCGGCGGGAGGG + Intergenic
1078053294 11:7985886-7985908 CAGTGGGACTGAGGGTGGGGTGG - Intronic
1078670086 11:13356922-13356944 CAAGGGGACTGGGGGTTGGAGGG - Intronic
1078986359 11:16603519-16603541 CTTTGGGAGTGGGGGTGGGAGGG + Intronic
1080864110 11:36178328-36178350 CAGTTGGGCTGGCGGCGGGGAGG - Intronic
1081473732 11:43403367-43403389 GAATGGGACTGGGGATGGGATGG - Intronic
1081733003 11:45384734-45384756 CTGTGGGGCTGGCGTTGGGGAGG - Intergenic
1081802416 11:45869263-45869285 CAGAGGGCCAGGCAGTGGGAAGG - Intronic
1081976045 11:47235409-47235431 CAAGGTGAGTGGCGGTGGGAAGG + Exonic
1082003666 11:47408458-47408480 CGGGGGGAGTGGCGGCGGGAGGG - Intronic
1082788447 11:57330628-57330650 CAGTGGGGCTGGGAGAGGGAGGG - Intronic
1083043477 11:59710864-59710886 CAGTGGGGGTGGGGGTGGGGTGG + Intergenic
1083871115 11:65489099-65489121 CAGTGGGGGTGGGGGTGGGGGGG + Intergenic
1084196254 11:67524769-67524791 CAGAGGGGCAGGCGGTGAGATGG - Intergenic
1084562030 11:69910630-69910652 CAGTGGAGCTTGTGGTGGGACGG + Intergenic
1084640735 11:70424214-70424236 CACTGGGACAGACGGAGGGAAGG + Intronic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085050296 11:73376795-73376817 CAGCGGAACTTGCGGTGTGAGGG + Intronic
1085465409 11:76719985-76720007 CAGTGGGGATGGGGGTGGGGTGG - Intergenic
1085958407 11:81429343-81429365 GAGTGGGAGTGGTGGGGGGAAGG + Intergenic
1086262895 11:84961932-84961954 CAGTGGGAGTGGGGCTGGGGTGG - Intronic
1088814222 11:113410447-113410469 TAGGGGGACTGGAGGTGGGAGGG + Exonic
1088884200 11:113994421-113994443 AAGTGGGACGGGGGTTGGGAGGG - Intergenic
1089531538 11:119133005-119133027 GAGTGGGGCTGGTGTTGGGAAGG + Intronic
1090026454 11:123171374-123171396 GAGTGGGACTGGAGAAGGGAGGG + Intronic
1090444993 11:126756731-126756753 CATTGGGAGTGGAGGTGGAATGG - Intronic
1090757338 11:129803961-129803983 GAGAGGGACTGGTGGTGGGTGGG - Intergenic
1091229923 11:133981586-133981608 CAGTGTGAGAGGCGGAGGGAAGG - Intergenic
1094761434 12:33537802-33537824 CACTGGGCCTGTCGGTGGGTGGG - Intergenic
1095090420 12:38099394-38099416 GAGGGGGAGTGGCGGTGGGGGGG + Intergenic
1096476190 12:51910733-51910755 CGGCAGGACTGACGGTGGGATGG - Intronic
1096521303 12:52186210-52186232 CAGAGGGCCTGGTGATGGGAAGG - Intronic
1096677462 12:53233339-53233361 CATGGGGACTGGAGTTGGGAGGG + Intergenic
1099959584 12:89383883-89383905 CAGTAGGGCTGGGGGCGGGAGGG + Intergenic
1100878571 12:98991026-98991048 CAGTGAGACTGGTTGTGTGATGG + Intronic
1101903692 12:108810072-108810094 CTGTGGGACAGGAGGTGGCAGGG - Intronic
1102296381 12:111740046-111740068 CAGTGGGAGTGGGGATGGCAGGG + Intronic
1102516033 12:113447385-113447407 CAGGGGGATTGGGGGTGGGGGGG + Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1104288828 12:127449840-127449862 CAGTGGGGCTGGCCCTGGGGTGG - Intergenic
1104760519 12:131295296-131295318 CAGTGGGACTCGGGGTTGGGGGG - Intergenic
1104819256 12:131665489-131665511 CAGTGGGACTCGGGGTTGGGGGG + Intergenic
1104820200 12:131672680-131672702 CAGTGGGAATGGGGGTGCAAAGG - Intergenic
1104965698 12:132507992-132508014 CTGTGGGACGGGGGATGGGAGGG - Intronic
1106013153 13:25844080-25844102 TAGTGGGACTGGGGGTGGCAGGG + Intronic
1106567696 13:30900565-30900587 CAATGGCAGTGGGGGTGGGAAGG + Intergenic
1106938122 13:34747098-34747120 GAGTGGGACCTGCGGTGGGCAGG + Intergenic
1109458557 13:62625560-62625582 CAGTGGGACGGGAGTTGGAAAGG + Intergenic
1110881578 13:80578267-80578289 GAGAGGGACTGGTGGTGGGTGGG - Intergenic
1112497469 13:99916245-99916267 CCCTGGGACTGGGAGTGGGAGGG - Intergenic
1113638397 13:111938117-111938139 CCGAGGGCCTGGAGGTGGGAAGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115471041 14:33768940-33768962 CACTGGGATTGGTGGTGGTATGG + Intronic
1115546163 14:34466534-34466556 GGGTGGGACTGGGGGTGGGGCGG - Intergenic
1118003562 14:61545289-61545311 CACTGGGGCTGGTGGTGGGAAGG - Intronic
1118312573 14:64704561-64704583 CTGAGGGGCTGGCGGTGGGCGGG + Exonic
1119130596 14:72168999-72169021 CAGTGGCAGTGGGGGTGGGCAGG - Intronic
1119959155 14:78834950-78834972 CAGATGGACTGGGGGTGGGTTGG - Intronic
1121580208 14:95024479-95024501 CAGTGTGGCTGGCGGAGGTAAGG - Intergenic
1122202043 14:100128591-100128613 AGGTGGGACTGGGGGTGGGGGGG - Exonic
1122506461 14:102234893-102234915 CAGCAGGACTGGCAGAGGGAGGG - Intronic
1122772910 14:104105148-104105170 GAGTGGGGCTGGCCTTGGGAGGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1123118191 14:105904174-105904196 CATTTGGACTGGCGTTGGGAGGG + Intergenic
1124350922 15:28955003-28955025 CAATGGGGCTGGGGGTGGGCCGG - Intronic
1124380750 15:29162773-29162795 GAGAGGGACTGGCTGTGGGCTGG - Intronic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124954038 15:34348192-34348214 CAGTGGGGCTGGGGCTGGCAAGG + Exonic
1125919560 15:43517589-43517611 GAGTGGGGCGGGCGGTGGGGGGG - Intronic
1128415050 15:67437015-67437037 GAGAGGGACTGGCAGTGGGTGGG - Intronic
1128511607 15:68316989-68317011 CAGTGGGACTGGCTAAGGGCAGG + Intronic
1128762891 15:70229932-70229954 CAGTAGGACTGGGATTGGGAAGG + Intergenic
1129256889 15:74338850-74338872 GAGTGGGAGTGGTGGTGAGAGGG - Intronic
1129518302 15:76170430-76170452 CAGTGGGCCTGGCCGATGGATGG + Intronic
1130443573 15:83978383-83978405 CAGTGGGAGAGGTGGAGGGATGG + Intronic
1131070492 15:89462680-89462702 CAGTCTGATTGGCTGTGGGAGGG - Intergenic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132500228 16:281731-281753 CAGGAGGACTGGGGGTGGGGAGG - Exonic
1132512648 16:352202-352224 CAGCGGGACTGGCGGCGCGGTGG - Intronic
1132598281 16:762958-762980 CAGTGGGGATGTCTGTGGGATGG + Intronic
1132662567 16:1068191-1068213 CAGTGTGGCTGATGGTGGGAGGG - Intergenic
1132812812 16:1809699-1809721 CAGTGGGACTGCCAGAGGGGAGG + Intronic
1133029770 16:3004804-3004826 CAGGGGCACGGGCGGTGGCAGGG - Intergenic
1133923970 16:10179875-10179897 AAGTGGGGGTGGGGGTGGGAGGG - Intronic
1136074196 16:27805774-27805796 CACTGGGATTGGGGGTGGGTTGG + Intronic
1136296859 16:29308846-29308868 CAGAGGGACAGGCAGAGGGATGG - Intergenic
1136296881 16:29308924-29308946 CAGAGGGACGGGCAGAGGGATGG - Intergenic
1136448864 16:30340969-30340991 CAGAGGCAGTGGCCGTGGGAGGG - Intergenic
1137363952 16:47844435-47844457 GAGTGGGATTAGGGGTGGGATGG - Intergenic
1137714645 16:50591299-50591321 CAGGGTGTCTGGCGCTGGGAGGG + Intronic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1138511028 16:57508452-57508474 CAGTGGAGCTGGGGGTGGGGTGG + Intergenic
1139370013 16:66461182-66461204 CAGGGAGACCGGGGGTGGGAAGG + Intronic
1139580862 16:67872971-67872993 GAGGGGGACTGGCTGCGGGAGGG + Intergenic
1140195042 16:72848640-72848662 CAGTGGCATAGGGGGTGGGAGGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141468979 16:84225768-84225790 CAGAGGGCCAGGCCGTGGGAGGG - Intronic
1141509136 16:84501398-84501420 AAGTGGGAGTTGGGGTGGGATGG - Intronic
1141555723 16:84835491-84835513 CAGAGGGCCTGGGGGTGGGTCGG - Intronic
1142058453 16:88015099-88015121 CAGAGGGACAGGCAGAGGGACGG - Intronic
1143273110 17:5690093-5690115 CAGTGGGGTTGGGGGTTGGATGG + Intergenic
1143576723 17:7798142-7798164 CCGTGTGACTGGGGGTGGGGTGG - Exonic
1143614652 17:8042620-8042642 CTGTGGGATTGGTAGTGGGAAGG - Intronic
1145089847 17:19977642-19977664 CGGGGGGACTGGCGCGGGGAGGG + Exonic
1145091270 17:19988054-19988076 CTGTTGGACTGGGGGTGGGGTGG - Intergenic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1145933156 17:28700264-28700286 GCCTGGGACTGGAGGTGGGAAGG + Intronic
1146183283 17:30710077-30710099 CAGGGTGCCTGGCGGGGGGAGGG + Intergenic
1147265349 17:39231336-39231358 CAGTGCCACGGGCAGTGGGAGGG - Intergenic
1147384685 17:40074295-40074317 AAGGGGGGCGGGCGGTGGGAGGG - Exonic
1147463165 17:40588964-40588986 GAGAGGGACTGGCGGTAGGCGGG + Intergenic
1147691013 17:42314464-42314486 CAGGGGGACTGGGGTCGGGAGGG + Exonic
1147948769 17:44095509-44095531 CTGTGGGAATGGGGGTGGGGTGG + Intronic
1148489895 17:48016257-48016279 CCTTGGGGCTGGAGGTGGGAGGG + Intergenic
1148849532 17:50548028-50548050 TCCTGGGCCTGGCGGTGGGAAGG - Intronic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1149808117 17:59638557-59638579 GGGTGGGAGTGGGGGTGGGATGG + Intronic
1150848990 17:68686803-68686825 CAGCGGGGCAGGGGGTGGGAGGG + Intergenic
1151403396 17:73871040-73871062 CATTGGGTCTGGGGGTGGCAGGG - Intergenic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1151691791 17:75691053-75691075 CAGAGGCACTGAGGGTGGGAAGG + Intronic
1152173400 17:78769504-78769526 CAGTTCCACTGGCGCTGGGATGG - Intronic
1152267509 17:79304947-79304969 CAGTGTGAGACGCGGTGGGAGGG - Intronic
1152295307 17:79463857-79463879 CAGTGGCAGTGGCGATGGGGAGG - Intronic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1152408228 17:80109361-80109383 CTGTGGGACTGGCTCAGGGAAGG - Intergenic
1152655561 17:81517762-81517784 GAGTGGGACTGGAGGGGGGGGGG - Intronic
1152753669 17:82078112-82078134 CGCTGGGACTGGCGGGGGGGGGG - Intergenic
1152795511 17:82304321-82304343 CCCTGGGGCTGGGGGTGGGAAGG + Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153146550 18:2039441-2039463 CAGTGGGATTGCCTGGGGGATGG - Intergenic
1154386917 18:13901972-13901994 CAGTGGGGCAGTCGGTGGGGGGG - Intronic
1157540883 18:48505674-48505696 GAGAGGGACAGGCGGTGGGCGGG - Intergenic
1157621488 18:49019491-49019513 CAGGGGGACTCCAGGTGGGAGGG - Intergenic
1158331487 18:56367894-56367916 GAGAGGGACTGGTGGTGGGCGGG + Intergenic
1158425070 18:57332108-57332130 CATTGGGGCTGGGGGTTGGAGGG - Intergenic
1160005322 18:75064600-75064622 CAGTGTGACTCTCGCTGGGAGGG - Exonic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1160895244 19:1399390-1399412 GTGTGGGCCTGGCTGTGGGATGG - Intronic
1161277985 19:3429610-3429632 CAGGGGGACTGGCGGGGGTTTGG + Intronic
1161497219 19:4593202-4593224 AAGTTGGGCGGGCGGTGGGAGGG + Intergenic
1162754952 19:12852265-12852287 CAGGGGGACTGGGGGTGAGCAGG + Intronic
1162975509 19:14205697-14205719 CAGGGTGCCTGGCGGGGGGAGGG - Intronic
1163085977 19:14979855-14979877 GAGGGGGACTGGGGGTGGGCGGG + Intronic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1164320148 19:24137288-24137310 CAGAGGGACTGGTGGTGGGTGGG + Intergenic
1165391674 19:35542660-35542682 CAGTGGGGCTGAGGGTGGGGAGG - Intronic
1165725524 19:38110122-38110144 GAGTGGGAATGGGGGTGGGTGGG + Intronic
1166009962 19:39934820-39934842 CAGCGGGTCTGGAGGTGGGTTGG + Intergenic
1166397447 19:42452151-42452173 CAGTGGTAGTGGTGGTGGTATGG + Intergenic
1166872470 19:45879233-45879255 CAGGGGGAGTGGAGGTGGGCGGG - Intergenic
1167014948 19:46835108-46835130 GAGTGGGACTGGGGATGGGAGGG - Intergenic
1167471822 19:49679817-49679839 TACTGGGAGTGGCTGTGGGAGGG - Intronic
1167728225 19:51233720-51233742 CAGTGGCACTGGAGGTTGGTTGG + Intronic
1168123822 19:54271891-54271913 AAGCGGGGCTGGGGGTGGGAGGG - Intronic
1168152762 19:54457847-54457869 CGGTGAGACTCGCGCTGGGAGGG + Exonic
1168178535 19:54643644-54643666 AAGCGGGGCTGGGGGTGGGAGGG + Intronic
1168275242 19:55274350-55274372 CAGGGGTGCTGGCGGTGGGGGGG - Intronic
1168379265 19:55906460-55906482 CAGTGGGGGTGGCAGTGGGTAGG - Intronic
1168412267 19:56147307-56147329 CAGTGTGACTCGCGGTGGGGAGG + Intronic
926108540 2:10167573-10167595 CAGCGGGCGTGGTGGTGGGAAGG + Intronic
926438068 2:12857839-12857861 CAGGGGCAATGGCAGTGGGAAGG - Intergenic
926750012 2:16191144-16191166 CAGAGGGAACGGCGGTGTGAGGG + Intergenic
927554671 2:24023389-24023411 CAGTAGGAATGGCGGGGGGCCGG + Intronic
927657071 2:24958206-24958228 GAGTGGAACTGGAGGTGGGACGG - Intronic
927690095 2:25202203-25202225 CAGTGGGAAGGGCCGTGGGGTGG - Intergenic
928593419 2:32839311-32839333 CAGGGGGACTGGCTGTGCTAGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931050436 2:58407671-58407693 CAGTGGCAATGGAGATGGGATGG - Intergenic
931396914 2:61895849-61895871 CAGTAGGGCTGGTGTTGGGATGG - Intronic
933877232 2:86631561-86631583 CAGGGGGACTGTAGGTGGCAGGG - Intronic
935242516 2:101190840-101190862 GGGTGGGACTGGGAGTGGGAGGG - Intronic
936903661 2:117512384-117512406 CAGTGGGACATACAGTGGGAAGG - Intergenic
936996288 2:118417453-118417475 CTGTGGGACAAGGGGTGGGAGGG - Intergenic
937004325 2:118497374-118497396 AAGTGGGACAGGCGGTTGGCAGG - Intergenic
937152655 2:119696605-119696627 CAGTGGGACAAGGGATGGGAAGG + Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
937857691 2:126684468-126684490 TAGTGGGCATGGTGGTGGGAGGG - Intronic
938166145 2:129028672-129028694 CAGAGGGGCTGGCAGTGAGAGGG + Intergenic
942088222 2:172462955-172462977 CAGCGGGACTGGAGGTGGCCAGG - Intronic
944528850 2:200648615-200648637 GAGAGGGATTGGCGGTGGGCAGG + Intronic
944838034 2:203598907-203598929 CAGTGGCAGTGGCAGTGGCATGG - Intergenic
946166388 2:217866702-217866724 CACTGGGGCTGGCAGAGGGAGGG + Intronic
946411124 2:219515640-219515662 CAGTTGGTCTGGCCTTGGGATGG - Intronic
946634464 2:221708918-221708940 CACTGGAAATGGCAGTGGGATGG - Intergenic
948398428 2:237664218-237664240 CAGTGGGACTGGCAGTGGAGAGG + Intronic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
1169115079 20:3059360-3059382 CAGTGGCAATGGTGGTGGGCAGG - Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1170017575 20:11799044-11799066 AGCTGGGAATGGCGGTGGGATGG - Intergenic
1171215688 20:23350714-23350736 CAGTGGGACTGCGGGCCGGAAGG - Exonic
1171461554 20:25300828-25300850 CACTGAGCCTGGCCGTGGGAAGG - Intronic
1172107988 20:32528016-32528038 CAGTGGGTCTTGGGGTGGGGAGG + Intronic
1172115036 20:32568670-32568692 CAGGGGCACAGGCGGTGGAAAGG - Intronic
1172222936 20:33286130-33286152 CAGTGGGACTGAGGGTGGCTTGG - Exonic
1172485855 20:35297566-35297588 CAGAGGGAGAGGGGGTGGGAAGG - Intergenic
1173607489 20:44341979-44342001 CAGTCAGAATGGCGGTGAGAAGG - Intronic
1173841775 20:46162112-46162134 CAGTGGGGGAGGCTGTGGGACGG - Intergenic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1175224918 20:57439317-57439339 CAGGGGGATGGGGGGTGGGAGGG - Intergenic
1175268139 20:57714898-57714920 CAGTGGGACGGCCAGGGGGACGG - Intergenic
1175268151 20:57714934-57714956 CAGTGGGACGGCCAGGGGGACGG - Intergenic
1176112207 20:63415867-63415889 GAGAGGGACAGGCCGTGGGAGGG - Intronic
1176428084 21:6560918-6560940 AAGAGGGACTGGCGGTAGTAGGG - Intergenic
1176703746 21:10093202-10093224 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1178127486 21:29530699-29530721 CACTGGGAGTGGTGGTGGAAAGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179661619 21:42879463-42879485 CTGTGGGACTGGCGTTGTGCGGG - Exonic
1179703575 21:43169235-43169257 AAGAGGGACTGGCGGTAGTAGGG - Exonic
1181059642 22:20276200-20276222 CTTGGGGACTCGCGGTGGGATGG - Intronic
1181087283 22:20447048-20447070 CAGTGGGAGTGGGGGAGGGGTGG - Intronic
1181093359 22:20489396-20489418 AAGTTGGACTAGAGGTGGGAGGG - Intronic
1182341320 22:29623493-29623515 CAGTGGGACTTGCTGGGGGTTGG + Intronic
1183048339 22:35240280-35240302 GAGAGGGACTGGTGGTGGGCAGG + Intergenic
1183265011 22:36819496-36819518 AAGTGAGCCTGGAGGTGGGATGG + Intergenic
949488288 3:4562941-4562963 CAGCATGACTGGGGGTGGGATGG + Intronic
949814288 3:8041256-8041278 GAGAGGGACTGGCGGTGGGCAGG - Intergenic
950041728 3:9924033-9924055 CAGTGGGAATGGACTTGGGAAGG - Intronic
950179575 3:10901586-10901608 CAGTGGGAACAGTGGTGGGAAGG - Intronic
951344859 3:21535862-21535884 CAGGGTGACTAGCGATGGGATGG - Intronic
952497638 3:33929769-33929791 CACTGGGGCTGTCAGTGGGAGGG - Intergenic
953556995 3:43953701-43953723 AAGTGTGTGTGGCGGTGGGAGGG + Intergenic
955042020 3:55327078-55327100 CACTGGGACTGGGGGCGGGGTGG - Intergenic
956084684 3:65597261-65597283 AATGGGGACTGGGGGTGGGAGGG - Intronic
959899076 3:111639594-111639616 GAGAGGGACTGGTGGTGGGCGGG - Intronic
960512824 3:118571496-118571518 GAGAGGGACTGGCAGTGGGCGGG + Intergenic
961448833 3:126993332-126993354 CCTTGGGACTAGGGGTGGGAAGG - Intronic
961589996 3:127971710-127971732 CAGTGGGACCCGCTGTGGGCAGG + Intronic
961636555 3:128336547-128336569 CAGTGGAACTGCGGGTGGCAGGG - Intronic
961821539 3:129577943-129577965 CAGTGGGCTCGGCGGTGGGTGGG + Intronic
966797617 3:183730553-183730575 CACTGGGCCTGGGGGTGGGGTGG + Intronic
968056594 3:195696803-195696825 CAGTGGGATGTGCAGTGGGAGGG - Intergenic
968977973 4:3831588-3831610 CAGCGGGAGTGGGGCTGGGAAGG - Intergenic
969470420 4:7384464-7384486 GACTGGGGCTGGCTGTGGGAAGG + Intronic
969667347 4:8567700-8567722 CATTTGGTCTGGCGGTGGGGTGG + Intronic
970658599 4:18260065-18260087 GAGAGGGACTGGTGGTGGGTGGG + Intergenic
972330333 4:38058158-38058180 CAGTGGGACTGGAGCTTGAATGG + Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975172768 4:71251483-71251505 CAGTAGTACTGGCTGTGGTACGG + Intronic
976686318 4:87819324-87819346 GAGAGGGACTGGTGGTGGGCAGG + Intergenic
976861170 4:89668840-89668862 AGGTGGGACTGGGGGTGGGATGG - Intergenic
977635448 4:99293037-99293059 CAGTGGGATTGGCTGTGGTCAGG + Intergenic
977638054 4:99323363-99323385 CAGTGGGATTGGCTGTGGTCAGG + Intergenic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
978396390 4:108285084-108285106 CAGTCTGATTGGCTGTGGGAAGG + Intergenic
978972912 4:114832599-114832621 CAGTGGGAATGAATGTGGGATGG - Intronic
980375962 4:131949554-131949576 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
980398783 4:132251942-132251964 CTCTGGGACTGGTGGTGGCAGGG + Intergenic
981387979 4:144153611-144153633 CAGTGAGGCTGGGGGTGGGGGGG - Intergenic
982744065 4:159087977-159087999 CAGTAGGAATGGTGGTGGGGAGG + Intergenic
986486439 5:8242879-8242901 CAATGGGACTGGCTGAGGCAAGG + Intergenic
988955680 5:36315750-36315772 TAGTGGGAGTGGGTGTGGGAAGG - Intergenic
989253541 5:39342820-39342842 CAGTGGGCCTAGGGGTGGAAAGG - Intronic
990326273 5:54678664-54678686 CAGTGGGAATGAGGATGGGAGGG + Intergenic
993371668 5:87100131-87100153 CAGTGGGAGTGGCAGTGTGCAGG + Intergenic
993378568 5:87179341-87179363 CAGTGAGACTGAGGGAGGGAGGG + Intergenic
993544915 5:89200107-89200129 CAGTTGGCCTGGTGTTGGGATGG + Intergenic
993894247 5:93512166-93512188 CAGTGGGACAAGATGTGGGATGG + Intergenic
993917076 5:93756339-93756361 CAGAGGGACCAGCGGTGGGCAGG - Intronic
994383718 5:99102807-99102829 AAGTGGATCTAGCGGTGGGAAGG + Intergenic
995968362 5:117937754-117937776 CAGTGGACCTGGCAGTAGGAGGG + Intergenic
997439116 5:133896779-133896801 CAGTTGGACTGGCACAGGGAAGG - Intergenic
997621978 5:135305109-135305131 CAGTGGGACTTCCTGGGGGAAGG - Intronic
998006358 5:138659574-138659596 CAGTGGTCCTGGGAGTGGGAAGG + Intronic
998159664 5:139806271-139806293 CAGCAGGGCTGGAGGTGGGAAGG + Intronic
999059719 5:148620357-148620379 CAGTGGGGATGGCAGTAGGAAGG + Intronic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999367437 5:151032293-151032315 CTGTAGGCCTGGCTGTGGGAGGG + Exonic
999394451 5:151218295-151218317 CAGCAGGACTGGCAGTGGGGAGG - Intronic
1000706227 5:164515493-164515515 CAGTGGAACTGGCCTAGGGAAGG - Intergenic
1001232519 5:170000995-170001017 CAGGGGGACTCATGGTGGGATGG + Intronic
1001515146 5:172350395-172350417 CAGAGGGACGGGCGGTTTGAAGG - Exonic
1001799299 5:174529524-174529546 CAGTAAGACTGGGGGTGGGGAGG - Intergenic
1002269587 5:178061656-178061678 CAGTGAGACTGGTGGTGGCCTGG + Intergenic
1002813877 6:660257-660279 GAGAGGGACTGGCAGTGGGCGGG - Intronic
1003487069 6:6588942-6588964 CAGTTGGAGTTGGGGTGGGAGGG + Intronic
1004367089 6:15021742-15021764 CCGTGGGACTGAGGGTGGAACGG - Intergenic
1005990577 6:30899420-30899442 CAGTGAGACTGCAGGTGGGCTGG + Intronic
1006122380 6:31815286-31815308 AAGGGGGAGTGGCGGTGGGAAGG - Intergenic
1006124239 6:31827482-31827504 AAGGGGGAGTGGTGGTGGGAAGG - Intergenic
1006513316 6:34533081-34533103 CGGTGGGACTGGAGGAGGAACGG + Exonic
1006713207 6:36094059-36094081 GAGTAGGAATGGGGGTGGGATGG - Intronic
1006750748 6:36375349-36375371 GGGAGGGACTGGTGGTGGGAGGG - Intronic
1007764983 6:44154918-44154940 CCGTGGGAGTGGGGGTGGGGTGG - Exonic
1007794651 6:44337681-44337703 CAGTGGGAGTGGACCTGGGAGGG + Intronic
1008326452 6:50187825-50187847 GGGTGGCAATGGCGGTGGGAAGG - Intergenic
1009061530 6:58402436-58402458 CAGTGGGCCTGGTGTTAGGAAGG + Intergenic
1009249201 6:61276983-61277005 TAGTGGGCCTGGTGGTAGGAAGG + Intergenic
1009408768 6:63341237-63341259 CAGTGGCAGTGGCAGTGGGCAGG + Intergenic
1010716208 6:79233523-79233545 CACTGAGGCTGGCGGTGGGAGGG + Intronic
1011789699 6:90885307-90885329 GAGAGGGACTGGCAGTGGGTGGG + Intergenic
1013005811 6:106072541-106072563 CTGTGGGACTAACTGTGGGAAGG - Intergenic
1014215508 6:118748946-118748968 CAGTGCGGGTGGCGGTGGGGTGG - Intergenic
1014284995 6:119487193-119487215 GAGAGGGACTGGCAGTGGGCAGG - Intergenic
1014531360 6:122563490-122563512 GAGAGGGACTGGTGGTGGGTGGG + Intronic
1015149399 6:130020380-130020402 CGGTGGCACGGGCGGGGGGAGGG + Intronic
1017190453 6:151648218-151648240 GAGAGGGACTGGCAGTGGGCGGG + Intergenic
1017715844 6:157212421-157212443 TGGTGGGGCTGGAGGTGGGAGGG + Intergenic
1017721769 6:157248083-157248105 CAGTGTGTCTGGGGGTGGGGTGG + Intergenic
1018009438 6:159655903-159655925 GAGAGGAACTGGCGGTGGGCGGG - Intergenic
1018050110 6:160001512-160001534 GACTTGGACTGGGGGTGGGATGG - Intronic
1018063989 6:160113043-160113065 TCGTGTGACTGGCAGTGGGAAGG - Intronic
1018710979 6:166497963-166497985 GAGTGGGATTGGGGGAGGGAGGG + Intronic
1019162898 6:170080880-170080902 CCGTGTGAGTGGCGGTGGGGCGG + Intergenic
1019448744 7:1084971-1084993 CAGAGGGAGGGGCGCTGGGAAGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019668374 7:2264253-2264275 CAGGGGCACGCGCGGTGGGACGG - Intronic
1022204386 7:28149468-28149490 CAGAGAGACTGGGGGTGGGGTGG - Intronic
1023869531 7:44255585-44255607 CAGTGGAGCAGGCGGGGGGATGG - Intronic
1024526991 7:50357349-50357371 CAGTGGACTTGGCGGTGGGGGGG - Intronic
1026398601 7:69985580-69985602 CAGTGGGAATGGAAGTGGGCAGG - Intronic
1026863590 7:73809614-73809636 CCGTGTGAGTGACGGTGGGAAGG + Intronic
1026902783 7:74046259-74046281 CAGAGGCTCTGGCGTTGGGAGGG + Intronic
1030936022 7:115585512-115585534 GAGAGGGACTGGTGGTGGGTTGG - Intergenic
1031103986 7:117516591-117516613 CAGTGAGGGTGGCGGTGGGGAGG + Intronic
1031761224 7:125715839-125715861 GAGAGGGACTGGCAGTGGGAGGG + Intergenic
1031944348 7:127823347-127823369 AAGTGGGAATGGCCTTGGGAAGG + Intronic
1032002014 7:128271690-128271712 CCGCGGGGCTGGTGGTGGGAGGG + Intergenic
1032429032 7:131846025-131846047 CAGAGGCAGTGGCGGTGGCAGGG + Intergenic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG + Intronic
1033379710 7:140803313-140803335 GAGTGGAATTGGGGGTGGGAGGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034978368 7:155460765-155460787 CAGTGGGCCTGGCTTTGGTAGGG - Intronic
1036846238 8:12172744-12172766 CAGTGAGACTGCAGGTGGCAGGG - Intergenic
1036867604 8:12415063-12415085 CAGTGAGACTGCAGGTGGCAGGG - Intergenic
1037747222 8:21655542-21655564 CAGTGGGACTTGCTGTGGTTTGG + Intergenic
1037759026 8:21729752-21729774 CTTTGGGGGTGGCGGTGGGAGGG - Intronic
1037818310 8:22123622-22123644 GAGAGGGGCTGGGGGTGGGAGGG - Intronic
1038237112 8:25769664-25769686 GAGAGGGACTGGCAGTGGGCAGG - Intergenic
1038781951 8:30575625-30575647 CTGTGGGAGTTGTGGTGGGATGG - Intergenic
1039819998 8:41126682-41126704 AAGTGGGAGTGGGGGTGGGGCGG - Intergenic
1040056698 8:43064699-43064721 GAGTGGGACTGGCAGTGGGAGGG - Intronic
1040635642 8:49270319-49270341 GAGAGGAACTGGTGGTGGGAAGG + Intergenic
1040711509 8:50194969-50194991 CAGAGAGACAGGCGGTGGGCAGG + Intronic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042680494 8:71378192-71378214 CAGGAAGACTGGGGGTGGGAGGG - Intergenic
1045962042 8:107979792-107979814 CAGTGGTACTTGAGGTGGGGAGG - Intronic
1046612953 8:116445941-116445963 CAGGGGGACTGGAGGAGGGGTGG - Intergenic
1047760001 8:127947488-127947510 CAGTGTGCCTGGCATTGGGATGG - Intergenic
1049215755 8:141407212-141407234 GAGAGGGACTGGAGGTGGGGAGG - Intronic
1049401082 8:142427664-142427686 CCGAGGGCCTGGGGGTGGGAGGG - Intergenic
1050876970 9:10651229-10651251 CAGTGGCAGTGTAGGTGGGAAGG - Intergenic
1052350922 9:27457579-27457601 CCTTGGGACTGGGGGTGGGGCGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1052997257 9:34557792-34557814 CAGAGGGCATGGTGGTGGGATGG + Intronic
1053641012 9:40080222-40080244 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1053765124 9:41385246-41385268 CAGAGGGAGTGGGGGTGGGAGGG - Intergenic
1054321756 9:63676518-63676540 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1054543740 9:66296408-66296430 CAGAGGGAGTGGGGGTGGGAGGG - Intergenic
1055056440 9:72028598-72028620 CAGGGGGATTTGCTGTGGGAAGG - Intergenic
1055346957 9:75349896-75349918 GAGAGGGACTGGTGGTGGGCAGG + Intergenic
1055357731 9:75454648-75454670 GAGTGGGAAGGGCTGTGGGAGGG + Intergenic
1055510563 9:76992076-76992098 CACTGGGTCTGGCGGTGTGAAGG - Intergenic
1055558599 9:77500594-77500616 CAGTGGGGATGGGGATGGGAGGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056322702 9:85451923-85451945 GAGAGGGACTGGCGGTGGGTGGG + Intergenic
1056369719 9:85941540-85941562 CAGTGGGACCGGGGCTGGGCTGG + Intronic
1056584706 9:87920443-87920465 CATTGGGCCTGGTGGTGGGGTGG - Intergenic
1056612168 9:88132497-88132519 CATTGGGCCTGGTGGTGGGGTGG + Intergenic
1056951429 9:91043466-91043488 CTGTGGGACTCGGTGTGGGAGGG - Intergenic
1057003855 9:91538176-91538198 GAGAGGGACTGGCAGTGGGCAGG - Intergenic
1057031173 9:91776265-91776287 CAGTGGGTCTGGGGATGGGGAGG - Intronic
1057160481 9:92885073-92885095 CATTGGGCCTGGTGGTGGGGTGG - Intergenic
1057335110 9:94149356-94149378 GAGTGGGACTAGGGGTGGGATGG - Intergenic
1058308378 9:103471201-103471223 AAGAGGGACTGGTGGTGGGCGGG + Intergenic
1059095671 9:111411089-111411111 CATTGGGATTCACGGTGGGAAGG - Exonic
1059449483 9:114361501-114361523 CAGTGGGATGGGAGGTGGCAGGG - Intronic
1060242402 9:121915096-121915118 CACTGGCAGTGGTGGTGGGAGGG + Intronic
1060406793 9:123376848-123376870 CAGTGGGAATGGCAGCGGCAGGG - Exonic
1060442588 9:123655538-123655560 AACTGGGAATGGCGGAGGGAGGG + Intronic
1060524898 9:124315000-124315022 AAGTGGGACTGCTGGTGGCAGGG + Intronic
1060831884 9:126722554-126722576 CAGCGGGGTGGGCGGTGGGAGGG - Intergenic
1061487011 9:130925117-130925139 CATGGGGAGTGGGGGTGGGACGG - Intronic
1062335903 9:136067310-136067332 CAGTGGGGGTGGGGGAGGGATGG + Intronic
1202788783 9_KI270719v1_random:63297-63319 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1186511199 X:10130898-10130920 CAGGGCGAGTGGCCGTGGGAGGG + Intronic
1187147531 X:16651168-16651190 TAATGGGACTGATGGTGGGAGGG + Intronic
1187773577 X:22730365-22730387 GAGAGGGACTGGCAGTGGGCGGG + Intergenic
1187826358 X:23335523-23335545 CAGTGGGCTTGGGGGTGGGGAGG + Intronic
1189880876 X:45491080-45491102 CAGTGGAGCTGGTGGGGGGAAGG - Intergenic
1190330162 X:49230793-49230815 CAGCGGGCCTGACGGTAGGAAGG + Intronic
1190334443 X:49253805-49253827 CAGTGGTGGTGGTGGTGGGAAGG + Intronic
1191045395 X:56130268-56130290 CAGTGAGACTGGCAGTGAGGTGG - Intergenic
1191792943 X:64990354-64990376 CAGAGGGAATGGTAGTGGGAGGG + Intronic
1191850076 X:65579804-65579826 GGGTAGGACTGGAGGTGGGAAGG - Intergenic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192881079 X:75284826-75284848 GAGAGGGACTGGTGGTGGGTGGG + Intronic
1192970247 X:76221112-76221134 GAGAGGGACTGGTGGTGGGCAGG + Intergenic
1193311923 X:80020686-80020708 CAGTGGTAGTGGTGGTGGTAGGG - Intronic
1193937652 X:87642005-87642027 GAGAGGGACTGGCCGTGGGTGGG - Intronic
1195679364 X:107532370-107532392 CAGTAGGACTGGAGTTGGTAAGG + Intronic
1196218929 X:113088526-113088548 AAGAGGGACTGGTGGTGGGTGGG - Intergenic
1197132433 X:123020279-123020301 GAGAGGGACTGGCAGTGGGCCGG - Intergenic
1197422683 X:126258123-126258145 CAGTGGCAGTGGCAGTGTGAAGG + Intergenic
1198221091 X:134603201-134603223 GAGTGGGACTGGGGATGGGGAGG + Intronic
1199643717 X:149885250-149885272 CAGTGGGGCAGGTTGTGGGAGGG + Exonic
1199872940 X:151914007-151914029 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199873467 X:151916051-151916073 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199874173 X:151918770-151918792 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1200000174 X:153056209-153056231 CAGTGGGGATGGGGGTGGGCGGG + Intergenic
1200397632 X:156000541-156000563 CAGCGGGACTGGGGGTGTCAGGG + Intronic
1200826471 Y:7649989-7650011 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1201306724 Y:12556784-12556806 GAGAGGGACTGGCAGTGGGTGGG - Intergenic
1202233428 Y:22679866-22679888 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic
1202309728 Y:23516292-23516314 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1202561073 Y:26154301-26154323 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic