ID: 1033224265

View in Genome Browser
Species Human (GRCh38)
Location 7:139548295-139548317
Sequence AGTCCCATAGCTGCTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033224265_1033224268 -1 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224268 7:139548317-139548339 TTGCCCCATAGTATACAGTTGGG No data
1033224265_1033224270 2 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224270 7:139548320-139548342 CCCCATAGTATACAGTTGGGAGG No data
1033224265_1033224273 5 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224273 7:139548323-139548345 CATAGTATACAGTTGGGAGGTGG No data
1033224265_1033224276 25 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224265_1033224277 28 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224277 7:139548346-139548368 CAAAGCCAGGATTTGTTGGGTGG No data
1033224265_1033224275 24 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224275 7:139548342-139548364 GTGGCAAAGCCAGGATTTGTTGG No data
1033224265_1033224274 15 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224274 7:139548333-139548355 AGTTGGGAGGTGGCAAAGCCAGG No data
1033224265_1033224267 -2 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224267 7:139548316-139548338 CTTGCCCCATAGTATACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033224265 Original CRISPR AGTCCCATAGCTGCTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr