ID: 1033224271

View in Genome Browser
Species Human (GRCh38)
Location 7:139548321-139548343
Sequence ACCTCCCAACTGTATACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033224271_1033224280 15 Left 1033224271 7:139548321-139548343 CCCATAGTATACAGTTGGGAGGT No data
Right 1033224280 7:139548359-139548381 TGTTGGGTGGTGGCAAAGCCAGG No data
1033224271_1033224278 5 Left 1033224271 7:139548321-139548343 CCCATAGTATACAGTTGGGAGGT No data
Right 1033224278 7:139548349-139548371 AGCCAGGATTTGTTGGGTGGTGG No data
1033224271_1033224277 2 Left 1033224271 7:139548321-139548343 CCCATAGTATACAGTTGGGAGGT No data
Right 1033224277 7:139548346-139548368 CAAAGCCAGGATTTGTTGGGTGG No data
1033224271_1033224276 -1 Left 1033224271 7:139548321-139548343 CCCATAGTATACAGTTGGGAGGT No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224271_1033224275 -2 Left 1033224271 7:139548321-139548343 CCCATAGTATACAGTTGGGAGGT No data
Right 1033224275 7:139548342-139548364 GTGGCAAAGCCAGGATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033224271 Original CRISPR ACCTCCCAACTGTATACTAT GGG (reversed) Intergenic
No off target data available for this crispr