ID: 1033224272

View in Genome Browser
Species Human (GRCh38)
Location 7:139548322-139548344
Sequence CACCTCCCAACTGTATACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033224272_1033224278 4 Left 1033224272 7:139548322-139548344 CCATAGTATACAGTTGGGAGGTG No data
Right 1033224278 7:139548349-139548371 AGCCAGGATTTGTTGGGTGGTGG No data
1033224272_1033224280 14 Left 1033224272 7:139548322-139548344 CCATAGTATACAGTTGGGAGGTG No data
Right 1033224280 7:139548359-139548381 TGTTGGGTGGTGGCAAAGCCAGG No data
1033224272_1033224276 -2 Left 1033224272 7:139548322-139548344 CCATAGTATACAGTTGGGAGGTG No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224272_1033224277 1 Left 1033224272 7:139548322-139548344 CCATAGTATACAGTTGGGAGGTG No data
Right 1033224277 7:139548346-139548368 CAAAGCCAGGATTTGTTGGGTGG No data
1033224272_1033224275 -3 Left 1033224272 7:139548322-139548344 CCATAGTATACAGTTGGGAGGTG No data
Right 1033224275 7:139548342-139548364 GTGGCAAAGCCAGGATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033224272 Original CRISPR CACCTCCCAACTGTATACTA TGG (reversed) Intergenic
No off target data available for this crispr