ID: 1033224276

View in Genome Browser
Species Human (GRCh38)
Location 7:139548343-139548365
Sequence TGGCAAAGCCAGGATTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033224266_1033224276 24 Left 1033224266 7:139548296-139548318 CCAGCTCAGCAGCTATGGGACTT No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224265_1033224276 25 Left 1033224265 7:139548295-139548317 CCCAGCTCAGCAGCTATGGGACT No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224269_1033224276 0 Left 1033224269 7:139548320-139548342 CCCCATAGTATACAGTTGGGAGG No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224271_1033224276 -1 Left 1033224271 7:139548321-139548343 CCCATAGTATACAGTTGGGAGGT No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data
1033224272_1033224276 -2 Left 1033224272 7:139548322-139548344 CCATAGTATACAGTTGGGAGGTG No data
Right 1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033224276 Original CRISPR TGGCAAAGCCAGGATTTGTT GGG Intergenic
No off target data available for this crispr