ID: 1033226542

View in Genome Browser
Species Human (GRCh38)
Location 7:139567504-139567526
Sequence CTCAAAGACGCCTCCAGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033226542_1033226546 1 Left 1033226542 7:139567504-139567526 CCATTTCTGGAGGCGTCTTTGAG 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1033226546 7:139567528-139567550 AGGGTTCTTTGGCTAAAGAAAGG 0: 1
1: 0
2: 2
3: 27
4: 186
1033226542_1033226545 -10 Left 1033226542 7:139567504-139567526 CCATTTCTGGAGGCGTCTTTGAG 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1033226545 7:139567517-139567539 CGTCTTTGAGAAGGGTTCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1033226542_1033226547 29 Left 1033226542 7:139567504-139567526 CCATTTCTGGAGGCGTCTTTGAG 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1033226547 7:139567556-139567578 TTTCACCTTCCTTTCCAATTTGG 0: 1
1: 1
2: 15
3: 237
4: 1392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033226542 Original CRISPR CTCAAAGACGCCTCCAGAAA TGG (reversed) Exonic
907629696 1:56068114-56068136 CTCCAAGATGTCTCTAGAAAAGG + Intergenic
908556141 1:65258272-65258294 CTCAAAGAAGCCTCCAGCTGTGG - Intronic
913067879 1:115273495-115273517 CTCAAATACCCCTACACAAAAGG + Intergenic
918130442 1:181622812-181622834 CTCAAATAGACTTCCAGAAAAGG - Intronic
921745857 1:218739970-218739992 CTCACAGTGTCCTCCAGAAATGG - Intergenic
922052863 1:222010926-222010948 ATCAAAGAGGCCTCCAGTGAGGG - Intergenic
922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG + Intergenic
923662658 1:235971925-235971947 CTCAAAGACAGTTCCAGAAGGGG - Intergenic
1066408355 10:35142022-35142044 CTCTAAAACGTCTCTAGAAATGG - Intronic
1074356577 10:112790958-112790980 CCCAAAGACCCCTCCTCAAAGGG + Intronic
1074452664 10:113571777-113571799 CTCAAGGAAGCCTCCAGCCAAGG - Intronic
1078095183 11:8292256-8292278 CTCTATGACGCCTTCAGGAAAGG - Intergenic
1079567743 11:21903507-21903529 CTCAAATACTCCTCTAGTAAAGG + Intergenic
1080738370 11:35039750-35039772 CTCCAAGACTCCTAGAGAAATGG - Intergenic
1080800250 11:35603681-35603703 CCCAATGAGGCATCCAGAAATGG + Intergenic
1084138299 11:67204453-67204475 ATCAAAGAAGCCTACACAAAAGG - Intronic
1084495295 11:69499956-69499978 CTCAGAGACGCCTCCAGATTCGG - Intergenic
1084752598 11:71214097-71214119 CTCACAGAAACCCCCAGAAAGGG + Intronic
1087363254 11:97187312-97187334 ATCAATGACATCTCCAGAAAAGG - Intergenic
1089857382 11:121558515-121558537 CTCAAATACTACTCCAGAAAAGG - Intronic
1090707316 11:129350459-129350481 CTCACAGACACACCCAGAAATGG - Intergenic
1091324356 11:134674412-134674434 CTCAAAACCTCTTCCAGAAAAGG + Intergenic
1094080709 12:26532343-26532365 ATAAAACACTCCTCCAGAAAAGG + Intronic
1099449254 12:82789067-82789089 CTCAAAGAAGCATCCCTAAATGG - Intronic
1101369318 12:104111006-104111028 CTCACAGACCCCTCCCAAAAAGG - Intergenic
1103921492 12:124401758-124401780 CTCCCAGACGCTTCCAGCAAGGG - Intronic
1106548318 13:30749785-30749807 TTCATAGACTTCTCCAGAAAAGG + Intronic
1110658310 13:78027134-78027156 TTCAAAAAATCCTCCAGAAAGGG - Intergenic
1120561406 14:85997954-85997976 TTTAAAGACCTCTCCAGAAATGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122820461 14:104342211-104342233 CCCAAGGACGCATCCAGTAAGGG + Intergenic
1123053371 14:105558616-105558638 CTCAAAGACGCGCCCAGATCAGG - Intergenic
1127840111 15:62823950-62823972 CACACAGAGGCCTGCAGAAAAGG - Intronic
1131123349 15:89837187-89837209 CTGAAAGACACCACGAGAAATGG + Intronic
1139784669 16:69383099-69383121 CACAAAGACTCTTCCAGAAGAGG + Intronic
1140058917 16:71550291-71550313 CTCAAAGACCGCCCCAGCAAAGG + Intronic
1140959379 16:79897475-79897497 CTCACAGATGCCCCCAGAAGGGG - Intergenic
1141407690 16:83808234-83808256 GCCAGAGACGCTTCCAGAAACGG - Intronic
1144540876 17:16141173-16141195 CTCAAAGGTGTCTCTAGAAATGG + Intronic
1145205018 17:20979733-20979755 CTCAAGGAAGTCTCCAGAACTGG - Intergenic
1157215876 18:45783002-45783024 CTGAAAGAGCCCTCCAGAAGAGG - Intergenic
1157925098 18:51755435-51755457 ATCAAAGGCTCCTGCAGAAATGG - Intergenic
1158648103 18:59265108-59265130 CGCAGAGACTGCTCCAGAAAGGG + Intergenic
1160058562 18:75509239-75509261 CTCACAGGGGCCTTCAGAAAAGG + Intergenic
1160896036 19:1402338-1402360 CCCAAAGACGCCTCCAGTTCTGG + Intergenic
1161956138 19:7496302-7496324 CCCAAAGTAGCGTCCAGAAAAGG - Intronic
1162114271 19:8419026-8419048 TTCAAGGAGGTCTCCAGAAAGGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163926375 19:20348341-20348363 CTAAATAAGGCCTCCAGAAAAGG + Intergenic
928027647 2:27753017-27753039 CCCAGAAACGCCTCCCGAAACGG - Intergenic
930458496 2:51638415-51638437 ATCATAGAAGCCTCGAGAAATGG + Intergenic
931597529 2:63965834-63965856 CTCAAAGTTGCTTCAAGAAAAGG - Exonic
933120693 2:78533327-78533349 CTCAAACTCCCCTTCAGAAAAGG - Intergenic
933451395 2:82457345-82457367 TTCAAAGACGCTTAAAGAAATGG + Intergenic
936386540 2:112034808-112034830 CTACAAGAAACCTCCAGAAAAGG + Intergenic
936461257 2:112715091-112715113 CTCAAAGAGGTCACCAGAACCGG - Intergenic
937369457 2:121287204-121287226 CTCAAGGACGAGTCCAGCAAAGG - Intergenic
940201869 2:151160679-151160701 CTCAAAGACACAACCAGAACAGG - Intergenic
942540420 2:177009573-177009595 GTGAAACACCCCTCCAGAAATGG - Intergenic
944336928 2:198544867-198544889 CCCAAAGAGGCCTCCATAAAAGG - Intronic
945080052 2:206079477-206079499 CTCACAGACGGCTGCTGAAATGG - Intronic
947528477 2:230893877-230893899 CTCCATGACGCCTGGAGAAAGGG - Intergenic
948201988 2:236136095-236136117 CTCAAAGAGGCCTCCACACCTGG + Intergenic
948697626 2:239741046-239741068 CCCCAAGACGCCTCCTGGAAGGG - Intergenic
1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG + Intronic
1179922565 21:44515036-44515058 CCCGCAGACCCCTCCAGAAAGGG + Intronic
950350842 3:12350498-12350520 TTCAAAGACGCCCCCACACAGGG - Intronic
952818842 3:37468491-37468513 CTCAAAGGGGACTCCAGCAAAGG - Intronic
961426925 3:126855734-126855756 TGCAAAGATGCCTACAGAAATGG - Intronic
961471046 3:127112902-127112924 CTCATAGACTCTTCCATAAAGGG - Intergenic
962333751 3:134506149-134506171 TTCAAAGAGGTTTCCAGAAATGG - Intronic
962400168 3:135051577-135051599 CTCAAAGATGCCTCCAGGTGGGG - Intronic
966938900 3:184732840-184732862 CTCCAAGACGCGTCCCGGAAGGG - Intergenic
967268160 3:187709983-187710005 CTCACAGACACATCCAGAAATGG - Intronic
967745918 3:193054835-193054857 CTCAAAGACCTCTGCTGAAATGG + Intergenic
974336005 4:60545194-60545216 CTCAAGGACTCATACAGAAAAGG - Intergenic
974606840 4:64163748-64163770 TTCAAAGACACCTCCAGAAAAGG - Intergenic
977377762 4:96228864-96228886 ATCAAAAACACCTCTAGAAATGG + Intergenic
978970781 4:114803120-114803142 CTCACAAGCTCCTCCAGAAATGG + Intergenic
982221355 4:153128047-153128069 CTCAAAGGCGCCGCCAGACCCGG - Intergenic
986581763 5:9272746-9272768 CTCCAACACGCCTGCAGAAGAGG + Intronic
987524651 5:19031505-19031527 CTCAAACACAACTCCAGTAAAGG + Intergenic
988663925 5:33304137-33304159 CTCAAAGAAGTCTCCTGATAAGG - Intergenic
988798613 5:34675438-34675460 TTCTAAGACACATCCAGAAAAGG - Intronic
997113339 5:131099415-131099437 TTCTGAGAAGCCTCCAGAAATGG + Intergenic
1006894906 6:37461805-37461827 CTCAAAGTCCCCTCCAAAGATGG + Intronic
1007934736 6:45722903-45722925 CTCAAAGACACCAAAAGAAATGG - Intergenic
1011200745 6:84833160-84833182 CTCAAAGTCCCTTCAAGAAATGG + Intergenic
1011637966 6:89392143-89392165 CTCAAAGAAGGATCAAGAAAAGG + Intronic
1016505573 6:144775373-144775395 CTGAAAGACACCTCCAGATGAGG + Intronic
1018904686 6:168068851-168068873 CCCACAGAGGCCTGCAGAAAGGG + Intronic
1021179286 7:17487469-17487491 TTCAAAGAAGCCTCCAGAAATGG - Intergenic
1024497239 7:50062684-50062706 CTTAAAGACTCCTGGAGAAAGGG + Intronic
1026292969 7:69025310-69025332 CTCAAAGAGGCCACCAGTGAGGG + Intergenic
1033226542 7:139567504-139567526 CTCAAAGACGCCTCCAGAAATGG - Exonic
1039195518 8:35027061-35027083 CTCAAAGACACATACAGAAAAGG - Intergenic
1042193203 8:66208867-66208889 CTCAAAGACTCCTACAGGAAGGG + Intergenic
1046479142 8:114791915-114791937 CTCAAAGAGGCCCAAAGAAAAGG - Intergenic
1046598244 8:116286682-116286704 CTCAAACAAGCCTGAAGAAATGG - Intergenic
1046624908 8:116566189-116566211 CTTAAAATCGCTTCCAGAAATGG + Intergenic
1048054501 8:130850457-130850479 GTTAAAGATGCCTCCAGAGATGG - Intronic
1049533087 8:143166151-143166173 ATCAAAGACGTCTGCAGAAATGG + Intergenic
1050802108 9:9628389-9628411 ATCAAAGATGCCAGCAGAAAGGG - Intronic
1059177621 9:112181602-112181624 CTCAAAGACGTCCCCAAAGAAGG - Intergenic
1186634887 X:11392253-11392275 CTGAAAGAGCCTTCCAGAAAAGG - Intronic
1187359161 X:18608856-18608878 GTCAAAGAGACCTCCAGAGAAGG + Exonic
1191699218 X:64021476-64021498 CTCACAGACACGCCCAGAAATGG - Intergenic
1193956175 X:87866064-87866086 CTCATGGACACATCCAGAAATGG + Intergenic
1195152486 X:102086067-102086089 GTCTAAGAAGCCTCCATAAAGGG + Intergenic
1197053595 X:122091281-122091303 CTCAAAGAGGTCTACAGAAAAGG - Intergenic
1198332118 X:135631609-135631631 CACAAAGATGGCTCCAGATAGGG - Intergenic
1198993053 X:142538360-142538382 ATCAAAGACACCTCAAGAACAGG - Intergenic