ID: 1033227251

View in Genome Browser
Species Human (GRCh38)
Location 7:139571832-139571854
Sequence AGCTAGGGTGGCGGCGCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033227251 Original CRISPR AGCTAGGGTGGCGGCGCCGA GGG Exonic
900217470 1:1489500-1489522 AGCTGGGGCGGCGGCGCACAGGG - Intronic
900224508 1:1526766-1526788 AGCTGGGGCGGCGGCGCACAGGG - Intronic
900399706 1:2467897-2467919 AGGCAGGGTGGGGGCGCCAAGGG - Intronic
902403010 1:16168051-16168073 AGCGAGGCTGGCGGGGCCCAAGG - Intergenic
902951017 1:19882750-19882772 AGCGAGGGAGGCGGCGCCGGGGG + Intronic
904527741 1:31146808-31146830 AGGTTGGGTGGCGGGGCCGGGGG + Intergenic
906209160 1:44002690-44002712 AGCCAGGGTGGTGGTGCCCAGGG - Intronic
907118643 1:51990365-51990387 ACCTAGGGAGGGGGCGCCGAGGG - Intronic
907184946 1:52602406-52602428 AGCCATGGTGGCGGCGACGGTGG + Exonic
910246513 1:85144172-85144194 AGCTAGAGTGCCGGCGGGGAGGG + Intergenic
921060278 1:211579104-211579126 AGCTAGAGAGGCGGCGGCCACGG + Intergenic
921355558 1:214281426-214281448 AGGTAGGGCGGCGGCGGCGGCGG + Exonic
1068955568 10:62816750-62816772 GGCTAGGGAGGCGGAGCCGCCGG - Intronic
1073325949 10:102644079-102644101 GGCGAGGGCGGCCGCGCCGAGGG - Intergenic
1076482857 10:130796254-130796276 AGCTAGGGTGCAGACGCGGAAGG - Intergenic
1088294642 11:108278664-108278686 AGCAAGGGTGGAGGCGGGGAAGG + Intronic
1096598672 12:52714392-52714414 AGCCGGGGTGGCGGCGGCGGCGG - Intergenic
1117042582 14:51780341-51780363 TGCTGGGGTGGCGGAGGCGAGGG + Intergenic
1122353759 14:101111782-101111804 AGGAAGGGTGGGGGCGCGGAGGG - Intergenic
1122517621 14:102319799-102319821 AGCGAGGATGGCGGCGGCGGCGG + Exonic
1122620934 14:103057402-103057424 TGGGAGGGCGGCGGCGCCGAGGG - Exonic
1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG + Intronic
1137619739 16:49868403-49868425 AGCTAGGGGTGCGGGGCCGCCGG + Intergenic
1143590888 17:7885332-7885354 AGCCGGGGTGGCGGCGGCGGCGG - Intronic
1143747291 17:9003632-9003654 AGCGAGGGGTGCAGCGCCGAGGG - Intergenic
1147028412 17:37609377-37609399 TGATAAGGTGGCGGCGGCGAAGG - Exonic
1160797669 19:953360-953382 GGCTCGGGTGGTGGCGCCGGTGG - Intronic
1161103233 19:2431704-2431726 AGCTGCTGTGGCGGCCCCGAGGG + Intronic
1161443360 19:4304844-4304866 AGCTGGGGTGGAGGCGGGGAGGG - Intronic
1161622816 19:5308220-5308242 ATCCAGGGTGGCAGCGTCGAGGG - Intronic
1162393487 19:10403506-10403528 GGCTCGGGTGGCGGCGACGGCGG + Exonic
1163606937 19:18280868-18280890 AGCTACGCGGGCGGCGCCGGGGG - Exonic
1165488373 19:36109083-36109105 AGCAAGGGTGGCAGTGCTGAGGG - Intergenic
1165760079 19:38315918-38315940 GGCTTAGGTGGCGGCGGCGAAGG - Exonic
1165920844 19:39297073-39297095 AGCTAGGGAAGTGGGGCCGATGG - Intronic
1168343205 19:55637636-55637658 CGCTGGGGTGGCAGCGGCGATGG + Intronic
932763794 2:74457738-74457760 AGCAAGCGTAGCGGCGCGGATGG - Exonic
934759814 2:96848286-96848308 AGATAGGGTGGCGGCTCAGCTGG + Exonic
938639760 2:133266452-133266474 GGCTAGGGTGGCGGCGCGCAGGG + Intronic
1176311760 21:5154415-5154437 AGCTGGGACGGAGGCGCCGACGG - Intronic
1179845290 21:44107620-44107642 AGCTGGGACGGAGGCGCCGACGG + Intronic
1179912371 21:44456949-44456971 CGCGAAGGTGGCGGAGCCGATGG - Exonic
1180876651 22:19178072-19178094 ACCCAGGGCGGCGGCACCGAGGG - Intronic
1180975941 22:19848524-19848546 AGGTAGGGTGGAGGCAACGATGG - Exonic
953149332 3:40309981-40310003 AGGGAGGGAGGCGGCGGCGACGG - Intronic
954649847 3:52154373-52154395 GGCGGGGCTGGCGGCGCCGAAGG + Exonic
961558112 3:127710525-127710547 AGCTTGGGTGGCTGCCCCCATGG - Intronic
970441388 4:16083506-16083528 GGCCAGGGAGGCGGCGCAGATGG + Intronic
972817180 4:42657142-42657164 AGCTCGGGCGCCGGCGCCGGGGG + Intergenic
986721194 5:10563027-10563049 AGCTAGGCTGGCGCAGCCGCTGG - Intergenic
990825460 5:59893429-59893451 GGCGAGGGTGGCGGCGGCGGGGG + Exonic
998119095 5:139561530-139561552 AGCTACGGCGGCGGCGGCGGTGG + Exonic
999663973 5:153893871-153893893 TGCTGGGGTGGCTGGGCCGACGG - Intergenic
1002927243 6:1611562-1611584 AGCTCGGGCGGCGGCGGCGGCGG + Exonic
1003664831 6:8101377-8101399 AGCTAGGGAGTAGGGGCCGAAGG + Intronic
1004924456 6:20403671-20403693 AGGGAGGGTGGCGGTGCCGGGGG - Intronic
1010926596 6:81752590-81752612 AGCTGGGGTGGCAGCGGCGCAGG - Exonic
1015220628 6:130801465-130801487 AGCCGGGGTGGCGGCGGCGGTGG + Intergenic
1016714108 6:147204112-147204134 GGCGACGGTGGCGGCGCCGGGGG + Intergenic
1019194633 6:170273926-170273948 AGCCAAGGTGGGGGCGCAGAGGG + Intergenic
1019712797 7:2525073-2525095 AGCTAGGGTGGGGGAGGCTACGG + Intronic
1028985948 7:97008049-97008071 GGCTGGGGTGGGGTCGCCGAGGG - Intronic
1033227251 7:139571832-139571854 AGCTAGGGTGGCGGCGCCGAGGG + Exonic
1035072899 7:156157862-156157884 TGCAAGGGTGGAGGTGCCGAGGG + Intergenic
1035171181 7:157018215-157018237 AGCTTGGGTGGCAGCGCAGGTGG - Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1038644561 8:29351151-29351173 CGCTAGGCGGGCGGCGCCAAAGG + Intergenic
1053069329 9:35091852-35091874 AGCTTGTGTGGCGGCGCTGGTGG - Exonic
1058843664 9:108934459-108934481 GGCGGGGGTGGCGGCGCCGGAGG + Exonic
1062583997 9:137240858-137240880 AGCTGCGCTGGGGGCGCCGAGGG - Intergenic
1185641585 X:1591850-1591872 GGCTTGGGAGGCGGCGCCTAGGG + Intronic
1188542642 X:31266914-31266936 AGCTTGGGCGGCGGCGGCGGCGG - Intronic
1189323076 X:40097816-40097838 AGCTAGGCGGGCGGCGGCGGCGG - Intronic
1189956923 X:46285558-46285580 AGCTAGGGTGGTTGCGGGGAGGG - Intergenic