ID: 1033231243

View in Genome Browser
Species Human (GRCh38)
Location 7:139599853-139599875
Sequence CAGAGTGCACAGTTAGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033231243_1033231244 -4 Left 1033231243 7:139599853-139599875 CCTAGGTCTAACTGTGCACTCTG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1033231244 7:139599872-139599894 TCTGCTGTACAATCTACTTTTGG 0: 1
1: 0
2: 0
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033231243 Original CRISPR CAGAGTGCACAGTTAGACCT AGG (reversed) Intronic
900142427 1:1144296-1144318 CCCAGGGCACAGTTAGACCCGGG + Intergenic
900772877 1:4559646-4559668 CAGAATGCAAAGTCAGATCTCGG - Intergenic
901596014 1:10385871-10385893 CAGGGTGCTCAGTTGGATCTAGG - Intergenic
905529387 1:38664601-38664623 GAGAATGCAGAGTTAGACCATGG - Intergenic
907650111 1:56286827-56286849 CAAAGAGCACAGATAGGCCTAGG + Intergenic
912373243 1:109189812-109189834 CAGAGGGTACAGTTTGACCGAGG + Intronic
916193825 1:162204547-162204569 CACAGTTCACAGTTAGAGCTGGG + Intronic
917035690 1:170744871-170744893 GAGAGTGTGCAGGTAGACCTGGG + Intergenic
919574658 1:199292974-199292996 AAGAGTGCACAGTCAGGACTGGG - Intergenic
920833158 1:209483280-209483302 CAGGTTGCACAGTTAGAAATTGG - Intergenic
1062981219 10:1724599-1724621 CAGAGAGCACAGTGGGACCCTGG - Intronic
1063499717 10:6542581-6542603 CAGAGTGAACAGTTCTCCCTCGG + Intronic
1066195209 10:33092461-33092483 CAGGGAGCACAGTTAGTCCCTGG + Intergenic
1071492283 10:86144027-86144049 CAGAGTGCTCAGTGAGTACTAGG - Intronic
1073477876 10:103766218-103766240 CACAGTGATCAGTCAGACCTTGG - Intronic
1074478669 10:113797445-113797467 CAGAGTGCACAGTTTGAAAAAGG + Intergenic
1074522966 10:114241232-114241254 CAAAGTTCACAGTTTGCCCTGGG + Intronic
1075876348 10:125809267-125809289 CTGATTGCAAAGTTGGACCTGGG - Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079133572 11:17763416-17763438 CAGAGTGCCCAGCCAGACCCTGG + Intronic
1079440982 11:20514700-20514722 CAGAATGAACTGTGAGACCTGGG - Intergenic
1083560147 11:63666820-63666842 CAGTATGCAGAATTAGACCTTGG - Intronic
1083812454 11:65113191-65113213 CACAGCGCACAGTGAGCCCTGGG - Intronic
1084935556 11:72584778-72584800 CAGAGGGGACTGTTAAACCTCGG + Intronic
1086396778 11:86423329-86423351 CACAGTGCACAGTTACTCCAAGG - Intergenic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1093098027 12:14994344-14994366 CAGAGAGCACAGATAGTCCATGG + Intergenic
1094070759 12:26410560-26410582 CAGAGGGCAAAGTTAGACTTAGG - Intronic
1095487319 12:42698805-42698827 CAGAGTTTACCCTTAGACCTTGG + Intergenic
1097475070 12:60043862-60043884 CAGAGAGCACATTTATGCCTTGG + Intergenic
1097710418 12:62911671-62911693 CAGAGTGCACAGGCAAAGCTAGG - Intronic
1101570875 12:105952506-105952528 CAGAGTGGACAGTGAGTGCTTGG - Intergenic
1101965756 12:109280941-109280963 CAGAGTCCGGAGTTAAACCTCGG - Intronic
1103175685 12:118861366-118861388 CAGCCTGCACAGATAGCCCTTGG + Intergenic
1104961857 12:132491854-132491876 CCGAGTGCACAGTCAGAGCTGGG + Intronic
1106665972 13:31851386-31851408 CAGAGCGCACTTTTAGACCAAGG + Intergenic
1110817202 13:79875280-79875302 CTGAGGGCACAGATAGACTTGGG - Intergenic
1111329839 13:86751019-86751041 CACTGTGCACATTTATACCTAGG - Intergenic
1115979549 14:39035049-39035071 CAGAGTCTGGAGTTAGACCTTGG + Intronic
1116228384 14:42182651-42182673 CAGAGTAGAGAGTGAGACCTGGG - Intergenic
1116399080 14:44483374-44483396 CAGAATGGCCAGTTAGAGCTAGG - Intergenic
1120453650 14:84703362-84703384 TAAAGTCCACAGTTAGAACTTGG - Intergenic
1121178315 14:91907577-91907599 AGGAGTGCACAGTGAGAGCTGGG + Intronic
1121212114 14:92214936-92214958 CAGAATGCCCAGTTAAACTTAGG + Intergenic
1122864363 14:104596856-104596878 CACAGTGCACAGTGGGACCAGGG + Intronic
1124925967 15:34070937-34070959 CAGTGAGCAGAGTTAGACCTTGG - Intergenic
1127007205 15:54583948-54583970 CAGAGAGCACAGTTAGGGCCTGG - Intronic
1127591969 15:60433953-60433975 CAGAGTTCAAATTTAGATCTGGG + Intronic
1130320658 15:82838060-82838082 GAGAGTGCACAGCAAGGCCTGGG + Intronic
1132294477 15:100725435-100725457 CAGTGTGCACAGGGAGACCCCGG + Intergenic
1132576370 16:666215-666237 CAGAGAGGACAGTCTGACCTGGG - Exonic
1132655266 16:1039315-1039337 CAGAGGGAACACTGAGACCTAGG - Intergenic
1133410172 16:5561719-5561741 CAGATTGCCCAGTAAGTCCTGGG - Intergenic
1137788891 16:51157860-51157882 CAAAGTCCACAGCAAGACCTGGG - Intergenic
1137858994 16:51827443-51827465 CACAGTGCCCAGTTAGTCCATGG + Intergenic
1138749187 16:59398231-59398253 CAGAGTCCACAGTGAAACCAAGG + Intergenic
1140790017 16:78382569-78382591 CAGAGTGGTCAGTAAGACGTGGG - Intronic
1141561502 16:84871005-84871027 CAGAGTGCACCAGTACACCTCGG - Intronic
1144224784 17:13134492-13134514 CAGAGTGCTCAGTCAGAACCAGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1148630553 17:49104960-49104982 CAGAGGGCACAGATACAACTGGG + Intergenic
1148840341 17:50491607-50491629 CAGAATGCAAAATTAGATCTGGG - Intergenic
1149810433 17:59664639-59664661 TAAGGTGCCCAGTTAGACCTTGG - Intronic
1157713115 18:49863601-49863623 CAGAGCACACAGGTAGACCCTGG + Intronic
1158169888 18:54585878-54585900 CAGAGTTCAAAGTTAGGACTTGG - Intergenic
1158613606 18:58965970-58965992 CAGAGAGCACAGTTAGAATCAGG + Intronic
1158677583 18:59535498-59535520 TAGTGTGCACACTTTGACCTTGG - Intronic
1161523075 19:4736668-4736690 CAGTGTGGACATTTAGGCCTGGG - Intergenic
1164940400 19:32248633-32248655 AAGAGTGTACAGGCAGACCTTGG - Intergenic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
925024881 2:599815-599837 CAGAGTCCACAGCAGGACCTGGG - Intergenic
926276509 2:11407251-11407273 CAGAGTGAAGAGTGAGACTTTGG + Intergenic
926330949 2:11824860-11824882 CGGAGTGCACAGCTCCACCTGGG + Exonic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
933144254 2:78831855-78831877 CACAGTGAAAAGTTAGAACTTGG - Intergenic
934580337 2:95432781-95432803 GAGAGTGCACAGTCAGATCTAGG + Intergenic
934599110 2:95643936-95643958 GAGAGTGCACAGTCAGATCTAGG - Intergenic
942496922 2:176549688-176549710 CACAGTGATCAGTTAGACATAGG - Intergenic
944882760 2:204030691-204030713 CAGAGTACACAATTATTCCTTGG + Intergenic
946132104 2:217614571-217614593 AAGAATGCAAATTTAGACCTTGG - Intronic
947397143 2:229697517-229697539 CAGATTCCACAGATATACCTGGG + Intronic
947703021 2:232251110-232251132 CAGAGTTTACACTTAGCCCTAGG + Intronic
1169682027 20:8226376-8226398 CAGTGTGCTCAGTATGACCTGGG - Intronic
1173318796 20:41969040-41969062 CTGACTGCAGAGTTAGCCCTGGG + Intergenic
1174406895 20:50308776-50308798 GAGAGCGCACAGTTAGCACTGGG - Intergenic
1176113172 20:63419682-63419704 AGGAGAGCACAGTTAGTCCTGGG + Intronic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1179586205 21:42375528-42375550 CAGAGATCACAGCTAGTCCTGGG - Intronic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182703608 22:32260650-32260672 CAGAGTGCACTGTTAGGGCAAGG - Intergenic
1184796361 22:46735702-46735724 CAGTGTGCCCAGATACACCTGGG + Intronic
950139864 3:10608004-10608026 CAAAGTGGACAGTGAGGCCTGGG - Intronic
952447157 3:33392315-33392337 CAAAGTGCTCAGTAAGACGTTGG + Intronic
952448737 3:33410260-33410282 CAGAGTTAACAGCAAGACCTTGG + Intronic
953912613 3:46900532-46900554 CAGAGGCCACAGGGAGACCTCGG - Intronic
956931461 3:74048207-74048229 CAGATTGTACAGTAAGACCAAGG + Intergenic
960931190 3:122852696-122852718 CAGAGTGCCCAGTTAAAACCCGG + Intronic
962251722 3:133839947-133839969 CAGAGTGGAGAGTGAGAACTGGG + Intronic
966811121 3:183845828-183845850 CAGAGTGCACCCTTAGGTCTAGG + Intronic
978829027 4:113060500-113060522 CAGAGTGGTCAGTTTGACCTGGG - Intronic
986383792 5:7211183-7211205 AAAAGTGCACAGTTACACCCAGG + Intergenic
987618948 5:20313695-20313717 GATAGTGCACAGTTAGAACATGG + Intronic
987683463 5:21166463-21166485 AAGAGTGCACAAATGGACCTAGG - Intergenic
996201200 5:120676434-120676456 CAGAGCAGAAAGTTAGACCTTGG + Intronic
999453215 5:151694023-151694045 CAGTGTGGACAGCTAGGCCTGGG + Intergenic
1000305929 5:159994680-159994702 CAGTGTGCCCAGTTACTCCTAGG - Intergenic
1000837525 5:166174987-166175009 CAGAGGACACAGTTTGTCCTTGG + Intergenic
1003968324 6:11274468-11274490 CAGAGAGCAAGGATAGACCTAGG - Intronic
1004595232 6:17093445-17093467 CAGGGTACACAGTTGGCCCTTGG - Intergenic
1007482733 6:42160795-42160817 CTGAGGGCACATTTATACCTGGG + Intronic
1010975389 6:82307074-82307096 CAGAGTGAACAGGAAGGCCTGGG + Intergenic
1014750854 6:125254414-125254436 AAGAGTGCAAAGTTAATCCTTGG - Intronic
1016916468 6:149248658-149248680 CAGAGGGCACAGGAAGAACTAGG - Intronic
1017792470 6:157813449-157813471 CTCAGTGCACAGTTAGCTCTGGG + Intronic
1022828595 7:34041981-34042003 CTGAGTGCCCAGTGAGACTTGGG - Intronic
1024299237 7:47873952-47873974 CACAGTGCACGGCTGGACCTTGG + Exonic
1025042760 7:55662447-55662469 CAGAATGCACATATAGGCCTGGG - Intergenic
1027361869 7:77417060-77417082 CAGAGTGCTCTGTTAGACCCTGG - Intergenic
1031316510 7:120264441-120264463 CAGAGGGCACAGTGAAACTTTGG - Intergenic
1032056298 7:128687252-128687274 CAGAGTTCACAGTTCCACCAAGG - Intergenic
1033231243 7:139599853-139599875 CAGAGTGCACAGTTAGACCTAGG - Intronic
1036808797 8:11853271-11853293 CAGTGTGCACAGACCGACCTGGG + Intronic
1037268444 8:17096204-17096226 CAAAGTGTCCAGTTACACCTGGG + Intronic
1039837401 8:41267774-41267796 AAAAGTGCACATTTAGACATGGG - Intronic
1040391306 8:46953047-46953069 TAGAGTGCACAGTGAGATGTGGG + Intergenic
1040715095 8:50241833-50241855 CAGAGTACGCAGGTAGAACTTGG + Intronic
1044052956 8:87532521-87532543 CACAGTGCACAGTGATCCCTGGG - Intronic
1044170894 8:89050229-89050251 CAGAGAGCTCAGGTGGACCTGGG + Intergenic
1047846829 8:128815236-128815258 CAGTGTGCACAGTTCTCCCTAGG - Intergenic
1049128154 8:140810865-140810887 CAGGGTGCACACACAGACCTGGG + Intronic
1049382306 8:142323405-142323427 CAGAGTGGACAGTGAGCCATCGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1051612439 9:18974414-18974436 CACAGTGAACAATCAGACCTTGG + Intronic
1056135237 9:83623881-83623903 TAAAGGGCACAGTTAGACTTTGG - Intronic
1057825933 9:98372042-98372064 CTGAGCCCACACTTAGACCTTGG + Intronic
1059575992 9:115489122-115489144 CAGAGTCCAGAGTCAAACCTGGG - Intergenic
1059769236 9:117412062-117412084 CAGAGTGCACAATGAGTTCTGGG - Intronic
1059795917 9:117696765-117696787 CACAGTGCCCAGTAATACCTAGG - Intergenic
1060295119 9:122338147-122338169 CAGAGCGCACAGTCAGGGCTGGG - Intergenic
1203488816 Un_GL000224v1:84359-84381 TGGAGTGCACAGTAAGAACTGGG + Intergenic
1203501437 Un_KI270741v1:26254-26276 TGGAGTGCACAGTAAGAACTGGG + Intergenic
1187105914 X:16241449-16241471 CAGAGTAGACAGTTTGAACTTGG + Intergenic
1187469468 X:19555859-19555881 CAGACTGCACCCTAAGACCTGGG + Intronic
1189579034 X:42386335-42386357 CACAGTGCAGAAGTAGACCTTGG + Intergenic
1190308855 X:49102317-49102339 CAGAGTGCACAGCCTGACCCTGG - Intergenic
1200324990 X:155228295-155228317 GAGATTGCACAGTTGAACCTAGG - Intronic
1201796778 Y:17904769-17904791 CAGAGTGCCCAGTGAGTCCCTGG - Intergenic
1201804775 Y:18001216-18001238 CAGAGTGCCCAGTGAGTCCCTGG + Intergenic
1202358157 Y:24073831-24073853 CAGAGTGCCCAGTGAGTCCCTGG - Intergenic
1202512621 Y:25596282-25596304 CAGAGTGCCCAGTGAGTCCCTGG + Intergenic