ID: 1033233499

View in Genome Browser
Species Human (GRCh38)
Location 7:139620114-139620136
Sequence ATGTGGGAATAGGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 615}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033233499_1033233512 1 Left 1033233499 7:139620114-139620136 CCCCCTTCCCCCTATTCCCACAT 0: 1
1: 0
2: 1
3: 61
4: 615
Right 1033233512 7:139620138-139620160 AGGACAGAGGAAAGCAGTAAGGG No data
1033233499_1033233513 2 Left 1033233499 7:139620114-139620136 CCCCCTTCCCCCTATTCCCACAT 0: 1
1: 0
2: 1
3: 61
4: 615
Right 1033233513 7:139620139-139620161 GGACAGAGGAAAGCAGTAAGGGG No data
1033233499_1033233514 22 Left 1033233499 7:139620114-139620136 CCCCCTTCCCCCTATTCCCACAT 0: 1
1: 0
2: 1
3: 61
4: 615
Right 1033233514 7:139620159-139620181 GGGAACCATCTCAGAAAGAATGG No data
1033233499_1033233511 0 Left 1033233499 7:139620114-139620136 CCCCCTTCCCCCTATTCCCACAT 0: 1
1: 0
2: 1
3: 61
4: 615
Right 1033233511 7:139620137-139620159 CAGGACAGAGGAAAGCAGTAAGG 0: 1
1: 0
2: 2
3: 74
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033233499 Original CRISPR ATGTGGGAATAGGGGGAAGG GGG (reversed) Intronic
900149092 1:1170524-1170546 AGGAGGGAGGAGGGGGAAGGAGG - Intergenic
900646999 1:3713477-3713499 GTGTGGGACTCGGGGCAAGGTGG + Intronic
900771518 1:4548389-4548411 ATGAGGGCATGGGTGGAAGGTGG + Intergenic
901301783 1:8204886-8204908 ATGTGTGAATATGGGAAAAGTGG + Intergenic
901365074 1:8739990-8740012 ATATGGCAATAGGGGAAAGAAGG - Intronic
901519077 1:9768950-9768972 AGGGAGGAAAAGGGGGAAGGAGG + Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901881321 1:12195512-12195534 AGGTGGGAAGAAGGGGCAGGTGG + Intronic
902176122 1:14652538-14652560 ATGGGTGAATAGGTGGATGGGGG - Intronic
902275034 1:15333343-15333365 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
903190064 1:21651367-21651389 ATGTGGGAGTAGGGGCAGGCAGG - Intronic
903774002 1:25781489-25781511 CTGTGGGAAGAGGAGGGAGGTGG - Intronic
903865070 1:26392016-26392038 ATTTGGGAGGAGGGGGAAAGAGG - Intergenic
904420633 1:30388911-30388933 AACTGGGAAGAGTGGGAAGGGGG - Intergenic
904834003 1:33323357-33323379 AAGTGGGAATGGCGGGTAGGGGG + Intergenic
905440929 1:37996328-37996350 CCTTGGGAAGAGGGGGAAGGGGG + Intergenic
905506198 1:38481475-38481497 AGGTGGGAATACCGAGAAGGAGG - Intergenic
905560968 1:38927061-38927083 AGGAGGGAAAAGGGGGAAGGAGG + Intronic
905975314 1:42170009-42170031 CTGTGGGAATGGGGGGACTGAGG - Intergenic
906558922 1:46739582-46739604 AAGGAGGAAAAGGGGGAAGGAGG - Intergenic
906562901 1:46772427-46772449 AGATGGCAAAAGGGGGAAGGAGG - Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908535029 1:65068340-65068362 CTTTGGGAAAAGGGGGAAAGCGG - Intergenic
909033877 1:70574554-70574576 AAGTGGTAAAAGGAGGAAGGAGG - Intergenic
909225178 1:73010939-73010961 AGGTGGTAATAGGGGGAGGAGGG - Intergenic
909944569 1:81649209-81649231 AGGTGGGATTAGGTGAAAGGCGG - Intronic
910223963 1:84917366-84917388 GTGTGGGTATAGGGGTAATGGGG + Intergenic
910893117 1:92038722-92038744 ATGGGGTAATAGGGGAATGGTGG + Intronic
911467478 1:98273665-98273687 TGGTGGGATTAGGGGGAGGGAGG + Intergenic
911487703 1:98523086-98523108 ATGCGGGAATAAGGGAAAGTGGG + Intergenic
911575665 1:99574417-99574439 ATGTGGGGCTAGGGAGAAGTGGG + Intergenic
912005597 1:104896110-104896132 CAGTGGGAAAAGGGGGAATGGGG + Intergenic
912412533 1:109488629-109488651 AGGTGGGAACAGTGGGAAGGAGG + Intronic
912917386 1:113829099-113829121 ACATGGGAGTAGGGGGAAGCAGG - Intronic
913524652 1:119679269-119679291 ATGGGGGAGTAGGGTGAGGGTGG + Intronic
914938765 1:152003734-152003756 ATGTGAGAATGGGGTGAAGCTGG + Intergenic
915000011 1:152580319-152580341 ATGTGGGAACTGGGGCCAGGAGG - Intronic
915907228 1:159887770-159887792 GTGCGGGAATAAGGGGAGGGCGG + Intronic
915910217 1:159910349-159910371 CTATGGGAATGTGGGGAAGGGGG - Intergenic
916804508 1:168245096-168245118 AATTGGGAGTAGGGGGAAAGAGG + Exonic
916917494 1:169425154-169425176 TTTGGGGAACAGGGGGAAGGTGG - Intronic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
917379156 1:174384295-174384317 ATTTGGGTATGGGGGGAATGAGG + Intronic
917680793 1:177365074-177365096 ATGAAGGAATAGGTGGAAGGTGG + Intergenic
917745502 1:178002946-178002968 AATTGGGTATAGGGGTAAGGAGG - Intergenic
918047899 1:180952462-180952484 AGGTGGGAGGAGGTGGAAGGGGG + Intergenic
918049920 1:180964981-180965003 AGATGGGGATATGGGGAAGGGGG - Intergenic
918078096 1:181185644-181185666 ACCTGGGAAGATGGGGAAGGTGG - Intergenic
919172944 1:193979088-193979110 AGGTGGGAAAAGGGAGAAAGGGG + Intergenic
919306225 1:195842302-195842324 GTGTGGGAAGAGTGAGAAGGAGG - Intergenic
919406877 1:197196222-197196244 ATATGAGAATAATGGGAAGGTGG + Intronic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919805950 1:201381096-201381118 ATGTGAGAAGAGGGGGGATGAGG + Exonic
920695844 1:208180853-208180875 ATGAGGGAAATGGGGGTAGGAGG + Intronic
920856155 1:209663909-209663931 ATGTGGGTTTAGGGGAGAGGAGG + Intergenic
920875041 1:209827079-209827101 ATGCGAGAATAGGGTGAGGGTGG + Intergenic
921472063 1:215561555-215561577 TTGTCGGAGTAGGGGGATGGCGG - Intergenic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922722661 1:227906571-227906593 ATGAGGGAGTAGGAGGAGGGAGG - Intergenic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
923689057 1:236175653-236175675 ATGGGGGAATCAGGGGAGGGGGG - Intronic
924554222 1:245104734-245104756 GTGTGGGGAAAAGGGGAAGGAGG - Intronic
1063422596 10:5925225-5925247 TTGTAGGAAAAGGGGGAAAGAGG - Intronic
1063661316 10:8036576-8036598 CTGCTGGAATAGGGGAAAGGGGG + Intergenic
1063767048 10:9154359-9154381 GTATGGGAATAGGGCGGAGGTGG - Intergenic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1064199342 10:13271632-13271654 ATGTGTGATTTGGGGGGAGGTGG + Intergenic
1064285801 10:13990343-13990365 ATGTGGGACAAGGAGGGAGGAGG + Intronic
1064704715 10:18059839-18059861 ATTTGGGCAAAGGGGGAATGAGG - Intergenic
1064885356 10:20105639-20105661 AGGTGGGGGTAGGGGGCAGGAGG - Intronic
1065020303 10:21496897-21496919 ATGCGGTAGTAGGGGAAAGGTGG + Exonic
1065024472 10:21527130-21527152 GGGTTGGAATCGGGGGAAGGAGG + Intergenic
1065368017 10:24953250-24953272 ATGAGGGAGGTGGGGGAAGGTGG - Intergenic
1065941281 10:30566196-30566218 TTGAGGGAATTGGGGGAAAGTGG - Intergenic
1066433942 10:35379370-35379392 ATGGGGGCAGAAGGGGAAGGTGG + Intronic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1067250751 10:44584683-44584705 ATGTGGGAAAAGAGGAGAGGGGG - Intergenic
1067363999 10:45608114-45608136 GGGAGGGAAAAGGGGGAAGGGGG + Intergenic
1067377147 10:45738113-45738135 ATGTGGGAACTGGGGGATGGTGG + Intronic
1067884855 10:50078805-50078827 ATGTGGGAACTGGGGGATGGTGG + Intronic
1068134193 10:52935560-52935582 AGGTGGGCACAGGGGTAAGGTGG - Intergenic
1069571568 10:69497548-69497570 ATGGAGAAATAGGGGGAAAGTGG - Intronic
1069940545 10:71952360-71952382 GTGTAGGAATAGGGGGAGAGCGG + Intergenic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070148544 10:73791836-73791858 CTGTGGGAACAAGGGGCAGGAGG - Intronic
1070195606 10:74153551-74153573 ACGTGGGATTAGGGGAAAGAAGG + Intronic
1070706837 10:78645922-78645944 CTTAGGGAACAGGGGGAAGGAGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072388194 10:94954412-94954434 ACATCGGAAAAGGGGGAAGGAGG - Intronic
1072681603 10:97511571-97511593 AGGTAGGAAGAGGTGGAAGGAGG - Intronic
1072904459 10:99439538-99439560 GGGTGGGAGTAGGAGGAAGGAGG + Intergenic
1073116563 10:101094808-101094830 AAGTGGGCACAGGTGGAAGGAGG - Intronic
1073212873 10:101818695-101818717 TTGGGGCAATAGGGAGAAGGGGG + Intergenic
1074035231 10:109731978-109732000 ATATGGGAAGAGGGAGGAGGTGG + Intergenic
1074326410 10:112455389-112455411 AAGGGGGAAAGGGGGGAAGGAGG - Intronic
1074872285 10:117586733-117586755 ATGGGTGAATAGGTGGATGGGGG - Intergenic
1075949834 10:126467665-126467687 ATGTGGGAAAAGGGGATATGGGG - Intronic
1076307956 10:129478015-129478037 TTGTGGGAATAGGGGACAGCAGG + Intronic
1076555281 10:131317525-131317547 ATGAGAGAATAGGGGCATGGAGG - Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077531316 11:3096963-3096985 AAGAGGAAAGAGGGGGAAGGTGG + Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1078088123 11:8246943-8246965 ATGTGGGGGTCTGGGGAAGGAGG - Intronic
1078590952 11:12640817-12640839 ATGTGGTGATGGGGGGATGGTGG - Intergenic
1079031523 11:16989793-16989815 ATGTGGGCATTGGGGGCGGGGGG - Intronic
1079205461 11:18410940-18410962 ATATGGGAAGTGGGGGTAGGAGG + Intergenic
1079891987 11:26067288-26067310 ATGTGGGAAGGAGGGGAAGTAGG - Intergenic
1080007064 11:27420758-27420780 ATGTGTGTCTTGGGGGAAGGTGG + Intronic
1081125705 11:39318582-39318604 AGGTGGGAATATGGAGAAAGAGG - Intergenic
1081737012 11:45411328-45411350 AGGTGGGAGAATGGGGAAGGGGG - Intergenic
1082082004 11:48019362-48019384 AGGTGGGGTTCGGGGGAAGGTGG - Intronic
1083305307 11:61758968-61758990 ATGTGTGAGTAGGGGGCAGGTGG + Intronic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084769302 11:71332255-71332277 ATGTGGGAAGAGGAGTAGGGTGG - Intergenic
1086268189 11:85027884-85027906 ATGTGGTAAGCGGGGGAGGGGGG + Intronic
1086480490 11:87231774-87231796 ATATGGAAATAGGGGGAAAAAGG + Intronic
1087365804 11:97217411-97217433 AAGGGGGAATAAGGGGAAAGTGG - Intergenic
1087774317 11:102243553-102243575 AGGAGGGAGAAGGGGGAAGGGGG + Intergenic
1088088412 11:106008527-106008549 ATTTGGGAGTAGGGGGTAGGTGG - Exonic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1089759966 11:120716008-120716030 ATGTGGGCAGTGGGGGAAGGCGG + Intronic
1090439407 11:126713477-126713499 ATGTAGGAAGATGGGGCAGGAGG + Intronic
1091406845 12:214456-214478 ATAGGGGAAAAGGGGGAAGGGGG - Intronic
1092069885 12:5623867-5623889 ATTTGGGAATGGGGGGTGGGTGG + Intronic
1092462580 12:8698702-8698724 TTGTGGGAAGGGGGGGGAGGGGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1094061865 12:26322884-26322906 AGTTGGGGATTGGGGGAAGGTGG - Intergenic
1094081844 12:26545361-26545383 ATGTGACAATTGTGGGAAGGGGG + Intronic
1095528553 12:43157439-43157461 ATCTGGAAATGGAGGGAAGGTGG + Intergenic
1095977881 12:47952129-47952151 CTGTGGGAAAAGGGACAAGGGGG + Intergenic
1096746781 12:53733896-53733918 CTATGGGAATCGGGGGAAGCGGG + Intergenic
1096975947 12:55699345-55699367 ATGAGGGAGTTGGGGGAAAGAGG - Intronic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097806482 12:63970051-63970073 GTCTGGGGAAAGGGGGAAGGTGG - Intronic
1098135763 12:67400170-67400192 ATGTGGGAATAAGGGAATAGAGG - Intergenic
1098367114 12:69715586-69715608 ATCTGGGAATGAGAGGAAGGAGG + Intergenic
1098877015 12:75876455-75876477 TTGTGGGGACAGGTGGAAGGGGG + Intergenic
1099532378 12:83800476-83800498 ATGGGGAAATAGGGAGGAGGAGG - Intergenic
1099662310 12:85579497-85579519 TTCAGGGAATAGTGGGAAGGGGG + Intergenic
1100490062 12:95070778-95070800 AAATGAGAATAGGGGGAAGTCGG - Intronic
1100522643 12:95390115-95390137 AAATGGCAAAAGGGGGAAGGAGG - Intergenic
1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG + Intronic
1100974742 12:100110940-100110962 ATGGAGGAATATGGGGATGGAGG + Intronic
1101239256 12:102821973-102821995 ATGTGGGAATAGCTGGTAAGCGG + Intergenic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1101835139 12:108289660-108289682 ATGTGGGAAGAGGGGAGATGGGG + Exonic
1102253575 12:111404014-111404036 ATGTGGGAAGAGGGGTGGGGTGG - Intergenic
1102488248 12:113272768-113272790 CTGTGGCCATATGGGGAAGGGGG + Intronic
1102787016 12:115613206-115613228 GTGAGGGAATTGGGGGATGGGGG + Intergenic
1102887728 12:116534222-116534244 ATGTTGGAGTGGGGGGAGGGGGG + Intergenic
1103501567 12:121407070-121407092 ATCTGGGGGGAGGGGGAAGGAGG - Intronic
1103796707 12:123508000-123508022 TAGGGGGAATAGGGGGAATGGGG + Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104625144 12:130346588-130346610 ATTTGGGAAAAGGGAGATGGGGG + Intronic
1104948744 12:132429279-132429301 ATGTGTGAAAATGGGGAAGTGGG - Intergenic
1104962909 12:132496708-132496730 ATGTGGGGAAACAGGGAAGGAGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1106405767 13:29471635-29471657 GTGTGGTAATAGTGGGAGGGAGG - Intronic
1106499607 13:30315348-30315370 AGGTGGGTATAGGCAGAAGGAGG - Intergenic
1106843674 13:33713517-33713539 AAGTGGGAAGAAGGAGAAGGAGG - Intergenic
1108378185 13:49833182-49833204 ATGTGGGAGTGAGGGGTAGGGGG + Intergenic
1110088324 13:71411118-71411140 AAGTGGAAATATTGGGAAGGAGG - Intergenic
1110219456 13:73058694-73058716 ATCTGGGAAGAGGGGGAATTAGG - Intronic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1112264055 13:97906295-97906317 ATGTGGTAAACGTGGGAAGGAGG + Intergenic
1112501436 13:99946239-99946261 TGGTGGGAGTAGGGGGTAGGGGG + Intergenic
1113528418 13:111000800-111000822 ATGTGAGGACAGTGGGAAGGTGG + Intergenic
1113645997 13:111996377-111996399 ATGTGGGAATGTGGGGAATGAGG - Intergenic
1113733386 13:112657981-112658003 GTTTGGGACTAAGGGGAAGGCGG - Intronic
1115160991 14:30393957-30393979 ATTTGGGAATAGTGAGAAGGTGG - Intergenic
1118461715 14:65993376-65993398 ATGTAGGCATATGGGGAAGAGGG + Intronic
1120234735 14:81876918-81876940 ATTTGGGAAAAGAGGGGAGGTGG + Intergenic
1120647236 14:87088626-87088648 AAGTGGGAAGTGGGGGAAGTTGG + Intergenic
1120995112 14:90411641-90411663 ATTAGGGGATGGGGGGAAGGAGG - Intergenic
1121048655 14:90805587-90805609 AGGTTGGAACAGGGGTAAGGAGG + Intronic
1121172254 14:91864322-91864344 GTAGGGGAGTAGGGGGAAGGAGG + Intronic
1121481169 14:94276005-94276027 ATGGGGGAAAAGGAGAAAGGAGG - Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121657830 14:95611084-95611106 ATGTGCAAAAAGGGGCAAGGAGG - Intergenic
1121714810 14:96066032-96066054 AGGTGGGGATAAGGGGGAGGAGG - Intronic
1121891013 14:97590546-97590568 ATCTAGGAAGAGTGGGAAGGAGG + Intergenic
1122825741 14:104369572-104369594 ATGTGGGGATTGGGGGAGAGGGG + Intergenic
1124439178 15:29674742-29674764 AGGAGGGAAAAGGGGGAGGGAGG + Intergenic
1124600178 15:31127488-31127510 ATGTGGTGAAAGTGGGAAGGTGG + Intronic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1124919659 15:34013736-34013758 ATGGGGGAGAAGGGGGAATGGGG + Intronic
1125600512 15:40912969-40912991 AAGGGGGAACAGGGAGAAGGAGG + Intergenic
1126237980 15:46407854-46407876 ATGTAGGAATAGAAAGAAGGAGG - Intergenic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127070994 15:55288916-55288938 ATGTTGGAATTGGGGGTAGAGGG - Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128793636 15:70449927-70449949 ATGGGTGGATAGGGGGATGGAGG + Intergenic
1129044973 15:72725965-72725987 AGATGGGAAAAGGGGAAAGGGGG - Intronic
1129144083 15:73632526-73632548 ATCTAGGGATAGAGGGAAGGTGG - Intronic
1129238227 15:74236510-74236532 ATGTGGGGGGAGGGGGAGGGTGG - Exonic
1129696484 15:77743221-77743243 AGGTGGGCATAGGTGGATGGAGG - Intronic
1130423720 15:83774689-83774711 AGGTGGAAATATGGGGAAGCAGG - Intronic
1130626912 15:85524848-85524870 ATGGGGAAAGAGGGGGCAGGAGG - Intronic
1130904070 15:88227753-88227775 AGGTGGGTAAAGGGGGAGGGAGG - Intronic
1131061084 15:89405089-89405111 ATGGAGGATTAGGGGAAAGGGGG + Intergenic
1131067778 15:89444926-89444948 ATGTGAGAAGAGTGGGAAGTGGG - Intergenic
1131291713 15:91112143-91112165 GGGTGGGGATAGGGAGAAGGGGG + Intronic
1132803684 16:1766162-1766184 ACGTGGGAATGAGGGGATGGGGG - Intronic
1133022710 16:2973958-2973980 ATGGGGGGCTAGGGGGAAGGTGG - Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133868466 16:9666059-9666081 ATGTGGATTTAGGGGGAGGGCGG - Intergenic
1134119984 16:11576965-11576987 ATGTGGGAACAGGGTGGTGGTGG + Intronic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1134458476 16:14411827-14411849 ATGGGGGAAGAGTGTGAAGGAGG - Intergenic
1136145265 16:28312697-28312719 CTGTTGGAACAGGGGCAAGGAGG + Intronic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138559142 16:57789627-57789649 ACGTGAGAAGAGGGGAAAGGAGG + Intronic
1139485352 16:67253116-67253138 ATGTGGTAACAGAGGGCAGGAGG - Intronic
1139495797 16:67316389-67316411 ATGTGGCAAGAAGGGTAAGGGGG - Intronic
1139640120 16:68285520-68285542 ATGTGGGAGTAGGGGGACAGTGG - Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140620238 16:76720880-76720902 TTGCGGGAAGAGTGGGAAGGGGG + Intergenic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141222627 16:82085300-82085322 TTGTGGGACAAGGGGGAAAGTGG + Intronic
1141514569 16:84535138-84535160 AGGAGGGAGTAGGGGGAGGGGGG - Intronic
1141829278 16:86500603-86500625 TTGTGGGAAGCTGGGGAAGGGGG + Intergenic
1142666743 17:1467753-1467775 ATGGGGGAATAGGGGGTGTGGGG - Intronic
1142992195 17:3739011-3739033 ATGAGGGAAGGGGAGGAAGGGGG - Intronic
1143371243 17:6441393-6441415 AAGAGGGAATATGGGGGAGGAGG + Intergenic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144621498 17:16821375-16821397 ATGTGGGAGCAGGGGGGAGGGGG + Intergenic
1144631524 17:16875070-16875092 ATTTGGAAATAGAGGAAAGGTGG + Intergenic
1144998477 17:19287235-19287257 TTGGGGGAACAGGGGGCAGGTGG - Intronic
1145851664 17:28104934-28104956 GTGTGGGAGTTTGGGGAAGGTGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146275727 17:31514430-31514452 ATGTGGCTGTAGGGGGAAGGTGG + Intronic
1146368619 17:32249687-32249709 AGGTGGGCAAAGGGGGAAGGAGG - Intronic
1146511874 17:33456413-33456435 ATCTGGGAATAGACTGAAGGGGG - Intronic
1146652309 17:34614272-34614294 ATGTAGGAATAGGGGTCAGGAGG - Intronic
1146946134 17:36874884-36874906 AGGTGGGGATAGGAGGGAGGAGG - Intergenic
1147053975 17:37819707-37819729 AAGGAGGAAGAGGGGGAAGGAGG - Intergenic
1147573470 17:41585689-41585711 ATGTGGGAGCAGGGAGGAGGGGG + Intronic
1148688400 17:49513279-49513301 GTGTGGGAGAAGGGGGCAGGTGG - Exonic
1148756841 17:49977645-49977667 AGGTGGGAAGAGGGAGAATGTGG + Intergenic
1148794961 17:50192533-50192555 AGGTGGGAAATGGGGGAAGAAGG + Intronic
1149287092 17:55176925-55176947 AGGTGGGGATAGGGTGAGGGTGG - Intergenic
1149442473 17:56686206-56686228 ATGTGGGTTTAGGGGCAGGGGGG + Intergenic
1149545455 17:57500274-57500296 ATGTGAGAAAAGGGGAAAGAAGG + Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1149658567 17:58323079-58323101 GTGTGGGGAGAGGGGGAATGTGG - Intronic
1149678319 17:58486794-58486816 ATGTGCCAATAGGTGGAAGGTGG + Intronic
1150244582 17:63664818-63664840 AAGTGGGAAAAAGAGGAAGGAGG - Intronic
1151229570 17:72674147-72674169 ATGTGGCAAGGGAGGGAAGGAGG - Intronic
1151339564 17:73461659-73461681 ATGGGTGAATAGGTGGATGGAGG + Intronic
1151578712 17:74965556-74965578 TTGTGGGGAAAAGGGGAAGGGGG - Intronic
1151990632 17:77571788-77571810 ATCGGGGAGGAGGGGGAAGGGGG + Intergenic
1152473569 17:80503539-80503561 ATGGGTGGATAGGGGGATGGAGG + Intergenic
1152565578 17:81098965-81098987 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565583 17:81098973-81098995 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565588 17:81098981-81099003 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152598381 17:81249277-81249299 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598386 17:81249294-81249316 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598391 17:81249311-81249333 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598396 17:81249328-81249350 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152777837 17:82213374-82213396 ATTAGGGAACTGGGGGAAGGAGG + Intergenic
1152970646 18:158422-158444 AGGAGGGAGGAGGGGGAAGGCGG - Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1154999807 18:21675087-21675109 ATCTGGGGATAGATGGAAGGAGG - Intronic
1155653119 18:28164509-28164531 ATCTGGGAAAACAGGGAAGGTGG - Intronic
1155840011 18:30632348-30632370 ATGTGGCAGGAGGGGGAAGTGGG + Intergenic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1156502595 18:37568908-37568930 AGGTGGGAGAAGGGGGAGGGTGG - Intergenic
1156841932 18:41619207-41619229 ATATGGGAATTGGGTAAAGGTGG - Intergenic
1156880202 18:42068603-42068625 ATGTGGGAAAAGTGGGAGGTGGG - Intronic
1157405493 18:47419273-47419295 AAGAGGAGATAGGGGGAAGGAGG + Intergenic
1157470103 18:47982463-47982485 ATGGGGGGATAGTGGGATGGGGG + Intergenic
1157868175 18:51204471-51204493 ATGTGTGGAGATGGGGAAGGTGG - Intronic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1158490717 18:57907265-57907287 GTGTGGGGAGAGGGAGAAGGAGG - Intergenic
1159186996 18:64988148-64988170 TTGTAGTAATAGGGGGCAGGGGG - Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159890814 18:73951414-73951436 ATGGGGGAAAATGGGGCAGGGGG + Intergenic
1160055090 18:75471551-75471573 ATGTGGGAAGCGGGGCAAGGAGG + Intergenic
1160448609 18:78946919-78946941 ATGAGGGAGGAGGGGGAGGGAGG + Intergenic
1160448633 18:78946991-78947013 AGGAGGGAAGAGGGGGAGGGAGG + Intergenic
1161010847 19:1958770-1958792 ATGGGGGGACAGGGGGACGGGGG - Intronic
1161168603 19:2801981-2802003 ATGTGGGTATCGGGAGATGGCGG - Intronic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1162550755 19:11357090-11357112 GGCTGGGAAGAGGGGGAAGGAGG + Intronic
1163169229 19:15519163-15519185 ATGTGGGCACAGAGGAAAGGGGG + Intronic
1163171642 19:15535590-15535612 ATGAGTGGATAGGTGGAAGGTGG - Intronic
1164592538 19:29514307-29514329 AGGGGGGATGAGGGGGAAGGAGG + Intergenic
1164592556 19:29514347-29514369 AGGGGGGATGAGGGGGAAGGAGG + Intergenic
1164592580 19:29514409-29514431 ATGGGGGATGAGGGGGAAGGAGG + Intergenic
1164709532 19:30345504-30345526 ATGTGGTAATAGCATGAAGGTGG + Intronic
1164838611 19:31375325-31375347 ATGAGGGAGTCGGGGGCAGGAGG - Intergenic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166794977 19:45420515-45420537 GTGTGGGAAGAGGTGGGAGGAGG - Intronic
1168020784 19:53607201-53607223 TTGTGGGAATAGGGGGAATCTGG - Intergenic
1168129055 19:54305770-54305792 GTGTGACAATAGGGGTAAGGAGG + Intergenic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925346410 2:3175063-3175085 ATGTGGTGATGTGGGGAAGGAGG - Intergenic
925900163 2:8503575-8503597 AGATGGAAATGGGGGGAAGGGGG - Intergenic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
926422800 2:12716276-12716298 ATGTGGGGATCGGGGGCAAGCGG + Intergenic
927287263 2:21369809-21369831 AGGAGGGAATAGTGGGAGGGAGG - Intergenic
927410331 2:22817699-22817721 ATGTTGGAATAGGATGAAAGTGG - Intergenic
928313488 2:30229637-30229659 ATTTGGGAAAATGGGGAGGGAGG + Intergenic
928734835 2:34276102-34276124 ATGTGGGAATAAAGAGAAAGAGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
929867551 2:45731035-45731057 ATGTGGGAATAGTGGGAGCCTGG + Intronic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
931074579 2:58695566-58695588 ATGTGGGAAAAGGTGCAAGGAGG - Intergenic
931763894 2:65437834-65437856 CTTTGGGAGGAGGGGGAAGGAGG + Intergenic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932455455 2:71846761-71846783 ATGTGGGAATTGCAGGCAGGGGG + Intergenic
932499881 2:72174047-72174069 CTGTGAGAAAAGGGGCAAGGTGG + Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932957475 2:76370830-76370852 ATTTGGGAACATGGGGAAGTAGG + Intergenic
933176998 2:79185818-79185840 ATTTGGGAACAGGGGAATGGAGG + Intronic
933628878 2:84633828-84633850 TTGTGGGAATCGGAGGAAGGGGG + Intronic
933837793 2:86259851-86259873 AAGTGGGAAGAGGGGAATGGGGG + Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
934653250 2:96104196-96104218 ATGGGGGAGGAGGGGGAAAGAGG - Intergenic
934844984 2:97656816-97656838 ATGTTGGGAGAGGGGGAGGGAGG - Exonic
935071781 2:99700796-99700818 AGATGGGGACAGGGGGAAGGAGG + Intronic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
936118508 2:109721842-109721864 TGGTGGGAATTGGGGCAAGGTGG - Intergenic
936490871 2:112971037-112971059 ATGTGAGAACAGAGAGAAGGCGG + Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936809790 2:116384335-116384357 ATGAGGGCCAAGGGGGAAGGTGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937034534 2:118769832-118769854 AGGAGGGAAGAGGGGGAAAGAGG + Intergenic
937230100 2:120393361-120393383 ATGTGGGTATAGGAAGGAGGAGG - Intergenic
937589752 2:123598642-123598664 AGGTGGTAATTGGAGGAAGGGGG + Intergenic
937858585 2:126690695-126690717 ATGTGGGATGAGGGAGACGGTGG - Intronic
937859086 2:126694282-126694304 ATGTGGGATGAGGGAGATGGTGG - Intronic
938242178 2:129751712-129751734 AAGGAGGAAGAGGGGGAAGGGGG + Intergenic
938951280 2:136256951-136256973 AGTTGGGAATAGCGGGTAGGGGG - Intergenic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
940781708 2:157940283-157940305 AGGTGGGAATGAGGAGAAGGGGG - Intronic
940800036 2:158123250-158123272 GTGTGCGGAAAGGGGGAAGGTGG + Intronic
942163508 2:173217262-173217284 ATGTGGAAAGACGGCGAAGGGGG - Intronic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942681442 2:178480927-178480949 ATGAGGGAAGAGGGGAGAGGCGG + Intronic
942826278 2:180180629-180180651 ATGCTAGGATAGGGGGAAGGAGG + Intergenic
944320577 2:198336922-198336944 ATCTGGGGGTAGGGCGAAGGAGG + Intronic
944388761 2:199194944-199194966 ATGAGGGAATGGGGAGGAGGAGG - Intergenic
944453386 2:199867478-199867500 ATTTGGGAGTAGAGGGGAGGTGG - Intergenic
944669667 2:201984460-201984482 ATGTGGGAACATGGGGAGGATGG + Intergenic
944837567 2:203595046-203595068 GTGTGGGGATAGGGGGAATATGG + Intergenic
945865278 2:215167641-215167663 GTGGGGGAATAGTGGGAGGGGGG + Intergenic
945988770 2:216375656-216375678 AGGTGGGAAGAGGGGGGAGGTGG + Intergenic
946014382 2:216592175-216592197 ATGTGGGAAATGGGGAAAAGGGG + Intergenic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948187228 2:236030928-236030950 AAGTGGGAAGAGGGAGAGGGAGG + Intronic
948513896 2:238490911-238490933 CTATGGGAATAGGGGTAAGGCGG - Intergenic
1169867383 20:10216854-10216876 AAGTTGGAATAGGGGGAAAGGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171335524 20:24381939-24381961 ATGTTTGAATGGGTGGAAGGAGG + Intergenic
1171510842 20:25683354-25683376 CTGGGGGAAATGGGGGAAGGAGG + Intronic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1173127833 20:40356351-40356373 ATGTGGGACTTGGGGACAGGAGG + Intergenic
1173351962 20:42253529-42253551 ATTTGGGAACTGGGAGAAGGAGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174289983 20:49501348-49501370 ATGGGGAAATAGGGAGAAGTAGG - Intergenic
1174468970 20:50741406-50741428 ATGTGGTAAAGGTGGGAAGGTGG - Intronic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174602079 20:51732825-51732847 ATGGGAGAAAAAGGGGAAGGAGG + Intronic
1174614237 20:51823662-51823684 ATGTGGGATTTGGGGGACTGGGG + Intergenic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1176124210 20:63468244-63468266 CTGTGGGAAGAAGGGGAATGTGG + Intronic
1176180506 20:63747414-63747436 AGGTTGGAAGAGGGGGCAGGGGG + Intronic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1178356423 21:31913478-31913500 GTGTGGGAATAGGGGCAGGGTGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181095351 22:20501326-20501348 AGGTGGCAAAAGGAGGAAGGGGG - Intronic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181386091 22:22546905-22546927 ATTTGGGAGTTGGGGGTAGGTGG - Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181696430 22:24595004-24595026 ATGTGAGAATACTGGGCAGGGGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181967644 22:26668098-26668120 ATGTGGGAAGTTGGGGATGGAGG + Intergenic
1182150855 22:28026176-28026198 TTGAGGGCAGAGGGGGAAGGGGG + Intronic
1182907485 22:33950555-33950577 ATGTTGGAAGAGGGGAATGGTGG + Intergenic
1182972147 22:34589038-34589060 AGGGGGGAAGAGGGGGAGGGGGG + Intergenic
1184039645 22:41935270-41935292 ATGCGGGCATGGGGGGGAGGGGG + Intergenic
1184974128 22:48048819-48048841 AGGTGGGAAGAGGGGTGAGGAGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949522295 3:4868439-4868461 AGGTGGCAAAAGGGTGAAGGCGG - Intronic
950333183 3:12173532-12173554 ATGTGGTAAAAGGGAGACGGTGG - Intronic
950483634 3:13260099-13260121 CTGGAGGAAGAGGGGGAAGGAGG + Intergenic
950624352 3:14233631-14233653 ATGGTGGAATGAGGGGAAGGTGG + Intergenic
950726671 3:14921462-14921484 ATGTGGGGAGATGAGGAAGGTGG + Intronic
950882022 3:16329652-16329674 AACTGGGAATACGGGGATGGGGG - Intronic
950924152 3:16723383-16723405 ATGAGGGCATAGTGAGAAGGTGG + Intergenic
953800034 3:46015836-46015858 CTGTGGGAATGTGGGGTAGGAGG - Intergenic
953972166 3:47356046-47356068 ATGTGGGATTAAGGGGAGGGTGG + Intergenic
954759966 3:52866934-52866956 ATGCAGGGATAGGGGGAATGTGG + Intronic
955684964 3:61540276-61540298 CTGTTGGAATAAGGGGGAGGAGG - Intergenic
955962637 3:64356600-64356622 AAGGGGGAATAGGGGAAAGGAGG + Intronic
955988904 3:64603884-64603906 ATTTGGAATTAGGGGGAATGGGG - Intronic
956693218 3:71896814-71896836 ATGTGGGTTTAGGGAGAAGGTGG - Intergenic
957124526 3:76141730-76141752 GTGTGGGCATAGGGGGAATGTGG + Intronic
957293532 3:78307406-78307428 ATGTTGGAAGAGGGGCATGGTGG + Intergenic
958963873 3:100536899-100536921 TTTTGGCAGTAGGGGGAAGGAGG + Intronic
959281540 3:104347939-104347961 AGATGGCAAGAGGGGGAAGGAGG - Intergenic
959317847 3:104831824-104831846 GTTTGGGAATAGAGTGAAGGTGG + Intergenic
959965982 3:112355425-112355447 AGGTAGGAATAGGGAGAAGCAGG - Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
961032520 3:123618995-123619017 ATGTCAGCATAAGGGGAAGGGGG - Intronic
961324145 3:126100201-126100223 ACGTGGCAAGAGGGGGAGGGAGG - Intronic
961514549 3:127424576-127424598 ATGTGTGAACAGGGAGAGGGAGG - Intergenic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961871789 3:129993701-129993723 ATGTGGAAAGAGGGAGTAGGAGG - Intergenic
961953687 3:130777301-130777323 AAGTGGGAATAGGGAGATGTTGG + Intergenic
964554344 3:157919208-157919230 ATATGGGAATAGGTGCAGGGCGG + Intergenic
965250235 3:166333163-166333185 ACTTGGGAATAGGGAGAAGAGGG + Intergenic
966638973 3:182168266-182168288 GCATGGGAAAAGGGGGAAGGAGG - Intergenic
966857554 3:184205700-184205722 AAGATGGACTAGGGGGAAGGGGG - Intronic
967282763 3:187837868-187837890 AGGTGAGAAAAGGGGCAAGGAGG + Intergenic
968481143 4:833565-833587 AGGAAGGAAGAGGGGGAAGGTGG + Intergenic
969695117 4:8729850-8729872 ATTTGGAAATAGGGTGGAGGCGG + Intergenic
970339763 4:15093676-15093698 CTTTGGGAATCTGGGGAAGGTGG - Intergenic
972418285 4:38863817-38863839 ATATTGGAATTGGGTGAAGGTGG - Intergenic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
975640040 4:76491200-76491222 ATGTGGGAATTAGGGAAAGGAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976353582 4:84088182-84088204 ATGTTGGAGTATGGGAAAGGAGG + Intergenic
976672551 4:87669920-87669942 ATGTGGGAATGGCGGGGGGGAGG + Intergenic
977785683 4:101032042-101032064 ATGAGGGAATGGGGGAAAGGTGG + Intronic
978006647 4:103625568-103625590 ATATGGGAGTAGGGGGTGGGGGG + Intronic
978404481 4:108364734-108364756 AGGTGGGAAGATGGGGAAGCAGG - Intergenic
979017717 4:115455223-115455245 GTGTGGGGATAGGGTGAAGGTGG + Intergenic
979654533 4:123176837-123176859 TTGTGGGAGGTGGGGGAAGGGGG + Intronic
980113290 4:128655004-128655026 ATGTGGAAAAGCGGGGAAGGGGG + Intergenic
980190689 4:129520510-129520532 AGGGGGGAGGAGGGGGAAGGAGG + Intergenic
980562995 4:134501976-134501998 ATGGGGGGAAAGGGGGCAGGCGG - Intergenic
980563007 4:134502003-134502025 AGGTGGGGGCAGGGGGAAGGGGG - Intergenic
982381210 4:154750505-154750527 ATGAGTGAATATGGGGAGGGCGG + Exonic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
985028024 4:185758655-185758677 AGGTGGTAAGAAGGGGAAGGTGG - Intronic
985669477 5:1200237-1200259 ATGTGGGCAGTGGGGGCAGGGGG + Intergenic
985672216 5:1212932-1212954 ATGTGGGACGAGTGGGAACGGGG - Intronic
985733031 5:1561511-1561533 ATGTGGGGATAAGGGGAAGGCGG + Intergenic
986372392 5:7092943-7092965 AGGTGGGAATGGGGAAAAGGAGG + Intergenic
986639684 5:9860081-9860103 AGGTGGCAATAAGGGGAAGAAGG + Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987297728 5:16568687-16568709 AAGGGGGAACAGGGGAAAGGGGG + Intronic
987410566 5:17610819-17610841 ATGTGGGAAGGGGAGGCAGGGGG + Intergenic
988799875 5:34686338-34686360 ATGTGGGAGTGGGGGGTTGGGGG + Intronic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
988845991 5:35128924-35128946 AAGAGGGAATACGGGGAAGGAGG - Intronic
989113499 5:37929663-37929685 AGGTGGGAAAAGGGGGCTGGGGG + Intergenic
989140713 5:38198748-38198770 TTCTGGGAAGTGGGGGAAGGAGG + Intergenic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990746842 5:58967256-58967278 ATGTGGGAACACAGGGAAAGAGG - Intergenic
991481967 5:67090399-67090421 ATGGGGGAAAAGTGGGGAGGGGG - Intronic
992146864 5:73859341-73859363 TTGTGGGAATATTTGGAAGGTGG + Intronic
992344753 5:75865446-75865468 ATGTGGGAATAGGGTGGAAAAGG + Intergenic
992617106 5:78555524-78555546 ATGTGGGCAGAGGGGGAAAGAGG + Intronic
992705464 5:79387003-79387025 AAGAAGGAAGAGGGGGAAGGGGG - Intronic
992787074 5:80180641-80180663 ATGCAGGAAAAGGGGGCAGGTGG + Intronic
992829978 5:80584651-80584673 AAGTGGGAAGAGGGGGAGGCTGG + Intergenic
994409424 5:99388166-99388188 AAGGGGGAAAAGGGGAAAGGGGG - Intergenic
994751255 5:103739634-103739656 ATGTGGGTATATGGGGTTGGGGG - Intergenic
995493983 5:112722557-112722579 ACTTGGGACTGGGGGGAAGGAGG - Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
996568964 5:124911763-124911785 GTGTTGGAATAGGGGGTGGGCGG - Intergenic
996687307 5:126297063-126297085 GTTTGGGAAGATGGGGAAGGGGG - Intergenic
997742056 5:136264323-136264345 AAGTGGGAAAATGGGGTAGGTGG + Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998670294 5:144345986-144346008 ATGAGGGACTTGGGGGGAGGTGG - Intronic
999152056 5:149432852-149432874 TTCTGGGAATTTGGGGAAGGGGG + Intergenic
999154680 5:149450047-149450069 ATGAGGGGATAGGGGGAAGTGGG - Intergenic
999265890 5:150266737-150266759 ATTTGGGAATTGGGGGCAAGTGG - Intronic
1001644348 5:173269160-173269182 ATGTGGGAAGTGGGTGGAGGAGG - Intergenic
1001972472 5:175967772-175967794 AGGAGGGAGTAGGGAGAAGGTGG - Intronic
1002244967 5:177876008-177876030 AGGAGGGAGTAGGGAGAAGGTGG + Intergenic
1002323524 5:178389930-178389952 ATGTGAGATTAGTGGCAAGGGGG - Intronic
1002934445 6:1659660-1659682 ATATGGGAGTATGGGGCAGGGGG - Intronic
1003450133 6:6223158-6223180 AGATGGAAATTGGGGGAAGGAGG - Intronic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1004604020 6:17177003-17177025 ATGTGGGAAAGGGGAGCAGGAGG - Intergenic
1006523159 6:34583737-34583759 AGGTGGGAATAGGGTGCAGAGGG + Intergenic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1007227585 6:40325778-40325800 ATGTGGGAACAGGGTGAAAGAGG - Intergenic
1007849838 6:44792469-44792491 ATGTGGGATTTAGGGGAAAGAGG + Intergenic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1008450806 6:51648123-51648145 AAATGGGAATAGGAGGAGGGAGG + Intronic
1008481413 6:51989846-51989868 ATGAAGGGATAGGGGGAGGGAGG + Intronic
1008551040 6:52631009-52631031 ATGAGGGAATACGGAGAATGAGG - Intergenic
1008700956 6:54098669-54098691 ATGTGGGAATAGGTAGAGGAAGG + Intronic
1009962618 6:70542035-70542057 AAGTGAGAATGGGGAGAAGGGGG - Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011531136 6:88322298-88322320 ATGTGGGAAAAGAGGAGAGGAGG + Intergenic
1011970050 6:93211415-93211437 AAGCGGGGAAAGGGGGAAGGGGG + Intergenic
1011970065 6:93211447-93211469 AAGTGGGGAAAGGGGAAAGGGGG + Intergenic
1013176063 6:107677937-107677959 AAGTGGGAGAAGGGGGAAAGGGG + Intergenic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1013693501 6:112673034-112673056 GTGAGGGAAGAGGGGAAAGGAGG - Intergenic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1015315837 6:131815096-131815118 ATTTGGGTATAGGGAGATGGAGG + Intronic
1015602083 6:134920425-134920447 CTGTGTGAATAGGGGAATGGAGG + Intronic
1015890890 6:137968595-137968617 GTGTAGGGAGAGGGGGAAGGAGG + Intergenic
1016091322 6:139982883-139982905 ATCTGGGGAGAGGGGGGAGGAGG - Intergenic
1016678468 6:146799716-146799738 ATGTGTGTGTAGGAGGAAGGGGG + Intronic
1017281601 6:152631730-152631752 AGGTGGGTATAGGTAGAAGGAGG + Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1017954695 6:159168766-159168788 AAGGAGGAATAGGGAGAAGGAGG + Intergenic
1018389155 6:163329678-163329700 TTCTGGGAATAGGGGGGAAGGGG - Intergenic
1019024605 6:168948606-168948628 ATGTGGGAGAAGGGTGAAGCTGG + Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1020713939 7:11646243-11646265 ATTTGGGAAGTGGGGTAAGGAGG - Intronic
1021042326 7:15877524-15877546 TTGTGGAAATAGAGGGAAAGTGG + Intergenic
1021283375 7:18747674-18747696 ATGTGAGAATCAGGGGAAGAAGG + Intronic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022487906 7:30794505-30794527 AGGTGGGGTTAGGGGGCAGGTGG + Intronic
1022568097 7:31423603-31423625 AGGGGGAAATAGTGGGAAGGGGG - Intergenic
1023035920 7:36131313-36131335 ATGTTGGCAGAGGGGGTAGGAGG + Intergenic
1023243208 7:38171777-38171799 GTTTGGGAGTAGGGGGAGGGTGG - Intergenic
1023410541 7:39885385-39885407 ATGAGGGAAGAGGGAGGAGGAGG + Intergenic
1024030300 7:45455044-45455066 ATGAGGGAGTAGGGGGATGGGGG - Intergenic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1025838830 7:65124262-65124284 ATTGGGGAAGAGGGGGAAGGAGG + Intergenic
1025884236 7:65571703-65571725 ATTGGGGAAGAGGGGGAAGGAGG - Intergenic
1025889207 7:65630903-65630925 ATTGGGGAAGAGGGGGAAGGAGG + Intergenic
1026046589 7:66909795-66909817 TGGTGGGAATTGGGGAAAGGAGG - Intergenic
1026140287 7:67699805-67699827 ATGTGGGAATCAGAGGAAGATGG - Intergenic
1026392565 7:69916693-69916715 ATGTAAGAATGGGGGGAAGAGGG - Intronic
1026861716 7:73794466-73794488 ATTTGGCAATATTGGGAAGGTGG - Intergenic
1028165627 7:87535159-87535181 CTGTGTGAATAGGCCGAAGGGGG - Intronic
1028415790 7:90579208-90579230 ATGAGGGAATACAGGGAGGGAGG + Intronic
1028879577 7:95864973-95864995 TTGTGGGGAAAGGGGGAAGGTGG + Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1029625375 7:101717586-101717608 ATGTGAGAACAGGCAGAAGGGGG - Intergenic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1031120502 7:117716369-117716391 ATTTGGGCTTATGGGGAAGGTGG + Intronic
1031853238 7:126891071-126891093 ATTGGGGAAGAGGGGGAAGGAGG - Intronic
1031920249 7:127595125-127595147 ATGAGGGGATAGTGGGAAAGTGG + Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033363143 7:140652063-140652085 GGGTGGGAAGAGGGGTAAGGAGG + Intronic
1034447053 7:151119095-151119117 ATGTGGGAAAAAGGAGGAGGAGG + Intronic
1034978622 7:155461854-155461876 CTGTGGGAATCAGGGGCAGGTGG - Intronic
1035116293 7:156527131-156527153 ATGGAGGATGAGGGGGAAGGTGG - Intergenic
1036382144 8:8243262-8243284 ATGTAGGCATAGCTGGAAGGTGG + Intergenic
1037070636 8:14643599-14643621 ATGAGGGAATAGGTTGGAGGTGG - Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037619801 8:20553533-20553555 AGGGGAGGATAGGGGGAAGGAGG + Intergenic
1038048148 8:23784577-23784599 ATGTGGGAAAAGGGCAAATGAGG - Intergenic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1038960438 8:32512129-32512151 ATGGGGGATGAGGGGGATGGAGG + Intronic
1039318390 8:36399282-36399304 TGGTGGGAATAGGAGCAAGGAGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039442708 8:37606366-37606388 ATATGTGAATAGGGTGAAGAGGG + Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039518810 8:38153943-38153965 AGGTGGGGGGAGGGGGAAGGCGG + Intergenic
1040099670 8:43487369-43487391 AAGTGGGAATAGGAGAAATGGGG + Intergenic
1040802734 8:51361512-51361534 ATGTAGGCATAGCTGGAAGGTGG - Intronic
1041212159 8:55563486-55563508 ATGGGGGAGTAGGGGTAAGCGGG - Intergenic
1041836505 8:62222756-62222778 ATCTGGGAAAAGGGGGAAAATGG + Intergenic
1042176514 8:66042668-66042690 AGGAGGGAAGAGGGAGAAGGAGG - Intronic
1042643764 8:70963109-70963131 AGGTGGGGACTGGGGGAAGGGGG - Intergenic
1042896889 8:73680151-73680173 AGGTGGGAATAGGGGGCCGGCGG + Intronic
1042977470 8:74485816-74485838 ATGGGGGATTAGGGGGAGTGTGG + Intronic
1043305395 8:78787262-78787284 ATGGGGGTGGAGGGGGAAGGAGG + Intronic
1043352959 8:79382755-79382777 ATGTTTGAAGAGGAGGAAGGAGG - Intergenic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1043988415 8:86721408-86721430 ATGGGGAAAGAGTGGGAAGGGGG + Intronic
1045064799 8:98435634-98435656 ATGTGGGATGAGGGAGAGGGAGG + Intronic
1046028634 8:108755929-108755951 ATATAGGAATGGGGGGAATGGGG + Intronic
1046318397 8:112537015-112537037 ATTTTGGGGTAGGGGGAAGGGGG + Intronic
1047040995 8:120995552-120995574 ATGTGAGGATAGGGAGAAGGTGG - Intergenic
1047196174 8:122723583-122723605 ATGAGGGGATTAGGGGAAGGTGG - Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048906489 8:139094113-139094135 ATGCAGCAATAGGGGGTAGGGGG + Intergenic
1049196037 8:141316174-141316196 CTGTGGAAATGCGGGGAAGGGGG + Intergenic
1050822357 9:9895295-9895317 AGGTGGTAACAGTGGGAAGGGGG + Intronic
1051128204 9:13829413-13829435 ATGTGGGGAAAAGGGGGAGGAGG + Intergenic
1051202441 9:14642661-14642683 ATGTGGGGACAGAGAGAAGGTGG + Intronic
1051563707 9:18472060-18472082 ATGTGTGAAGAGGGAGGAGGTGG + Intergenic
1052544014 9:29849690-29849712 ATGTGCAAATTGGGGGAGGGAGG + Intergenic
1052752334 9:32504248-32504270 ATGTGGGCACGGGGGGAATGTGG + Intronic
1052993306 9:34535402-34535424 ATGAAGGAAAAGAGGGAAGGAGG - Intergenic
1053158527 9:35796916-35796938 AGGTGGCAATAGAGGAAAGGAGG + Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053437482 9:38086064-38086086 GTGTGGGAGTATGGGGAATGAGG - Intergenic
1053450691 9:38191989-38192011 ATGTGGGGAGAAGGGAAAGGAGG - Intergenic
1054733999 9:68732120-68732142 ATGTTGGAATAGGGAGGTGGAGG + Intronic
1055186677 9:73464834-73464856 TTGTGGGAAAAGGTAGAAGGGGG - Intergenic
1055281336 9:74677834-74677856 ACGTGGAAATAGGGCGAAGTAGG + Intronic
1056250668 9:84744947-84744969 AAGTGGGCAAAGGGGGAATGAGG - Intronic
1056327936 9:85496165-85496187 GTGTGTTAGTAGGGGGAAGGAGG - Intergenic
1056807075 9:89737119-89737141 ATGGAGGACTTGGGGGAAGGGGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056962057 9:91134090-91134112 AGGAAGGAAGAGGGGGAAGGAGG + Intergenic
1057247250 9:93467247-93467269 ATGGGGGAAAAGGGGGGGGGGGG - Intronic
1057285891 9:93754018-93754040 ATGTGGGAATGGGAAAAAGGAGG - Intergenic
1057308213 9:93924803-93924825 ATGGTGGAGTAGGGGGAGGGCGG + Intergenic
1057873744 9:98737116-98737138 ATGTGTGTATAGGGGGCAGGGGG - Intronic
1058452469 9:105109992-105110014 ATCTGGGAGGAGGAGGAAGGGGG + Intergenic
1058938595 9:109792040-109792062 ATGTGGGAATGGGGGCTGGGGGG + Intronic
1059000420 9:110342696-110342718 ACGTGGGAATAGGGTGGGGGGGG + Intergenic
1059157276 9:112001337-112001359 AGGTGGAAATAGGGGGAGGCAGG - Intergenic
1060229630 9:121817270-121817292 ATGTGGGAATGAAGGGGAGGTGG + Intergenic
1060743275 9:126113448-126113470 ATGTGGGAGTTGGGGGACGATGG + Intergenic
1060851043 9:126876167-126876189 AAGGGGGAAAGGGGGGAAGGGGG - Intronic
1062640440 9:137515789-137515811 AGGGGGGATTTGGGGGAAGGGGG - Intronic
1185612973 X:1403046-1403068 ATTTGGGGAGTGGGGGAAGGAGG - Intergenic
1186534882 X:10336893-10336915 GGGTGGGAATAGGGAGATGGAGG - Intergenic
1186706004 X:12139414-12139436 ATTTAGGAGTTGGGGGAAGGCGG - Intronic
1187245616 X:17550696-17550718 AGGTGGGCAGAGGGGGAAGTGGG - Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188260599 X:28018400-28018422 ATGGGGGAGTAGGGGAAATGGGG - Intergenic
1189681193 X:43518442-43518464 AGGAGTGAATAGGGAGAAGGTGG + Intergenic
1190406245 X:50090575-50090597 ATGGGGGAAGACAGGGAAGGGGG + Intronic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191821310 X:65311990-65312012 GTCTGGGAGTAGGGGGCAGGGGG + Intergenic
1196047760 X:111274193-111274215 TTGTGGGGATAGTGGTAAGGAGG + Intergenic
1196531216 X:116788839-116788861 ATGGGGGGAAAGGGGGAAGGGGG + Intergenic
1196588131 X:117454142-117454164 ATGGGGGGATAGAGGGAGGGAGG - Intergenic
1197199573 X:123736267-123736289 TTGTGGGGATAGGGGGGATGGGG + Intergenic
1197408928 X:126091970-126091992 GTGAGGGGTTAGGGGGAAGGTGG + Intergenic
1197598637 X:128499368-128499390 TTGAGGGAGGAGGGGGAAGGAGG - Intergenic
1197702722 X:129611452-129611474 TTGGGGGAAGAGGGGGGAGGAGG + Intergenic
1197922047 X:131605360-131605382 GTCAGGGAATAGGGGGAAAGGGG - Intergenic
1198092575 X:133346173-133346195 ATGCAGAAAAAGGGGGAAGGCGG + Intronic
1198706770 X:139457594-139457616 ATGAGGTAATAGGGATAAGGAGG - Intergenic
1199228320 X:145406140-145406162 ATGAGGGAATTTGGGGAGGGTGG + Intergenic
1199428948 X:147736660-147736682 AGGAGGGAAGAGGGGGAGGGGGG - Intergenic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201319162 Y:12678235-12678257 ATATGGGCACTGGGGGAAGGAGG - Intergenic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic