ID: 1033238727

View in Genome Browser
Species Human (GRCh38)
Location 7:139659379-139659401
Sequence AAAAGGCTGCTCCTACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033238727_1033238733 20 Left 1033238727 7:139659379-139659401 CCTTCAAGTAGGAGCAGCCTTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1033238733 7:139659422-139659444 GGTTCCCTGGCCCTGAGCCGCGG 0: 1
1: 0
2: 2
3: 31
4: 277
1033238727_1033238729 -5 Left 1033238727 7:139659379-139659401 CCTTCAAGTAGGAGCAGCCTTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1033238729 7:139659397-139659419 CTTTTTTGAGTCCATCTTTTTGG 0: 1
1: 0
2: 3
3: 26
4: 316
1033238727_1033238732 7 Left 1033238727 7:139659379-139659401 CCTTCAAGTAGGAGCAGCCTTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1033238732 7:139659409-139659431 CATCTTTTTGGTAGGTTCCCTGG No data
1033238727_1033238734 21 Left 1033238727 7:139659379-139659401 CCTTCAAGTAGGAGCAGCCTTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1033238734 7:139659423-139659445 GTTCCCTGGCCCTGAGCCGCGGG 0: 1
1: 0
2: 3
3: 22
4: 244
1033238727_1033238735 22 Left 1033238727 7:139659379-139659401 CCTTCAAGTAGGAGCAGCCTTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1033238735 7:139659424-139659446 TTCCCTGGCCCTGAGCCGCGGGG 0: 1
1: 0
2: 3
3: 20
4: 227
1033238727_1033238730 -1 Left 1033238727 7:139659379-139659401 CCTTCAAGTAGGAGCAGCCTTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1033238730 7:139659401-139659423 TTTGAGTCCATCTTTTTGGTAGG 0: 1
1: 0
2: 2
3: 7
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033238727 Original CRISPR AAAAGGCTGCTCCTACTTGA AGG (reversed) Intronic
900001341 1:16591-16613 AAAGAGCTGCTCCCACCTGAAGG + Intergenic
900021061 1:187113-187135 AAAGAGCTGCTCCCACCTGAAGG + Intergenic
900293435 1:1935661-1935683 CAAAGCCAGCTCCGACTTGAGGG + Intronic
900767321 1:4514029-4514051 GAAAGGTGGCTCCTTCTTGAGGG + Intergenic
901376279 1:8841871-8841893 AAGAGGCTGCTCCTGATAGATGG - Intergenic
902124244 1:14195200-14195222 ATAAGGCTGTTCCTTCTTCAAGG + Intergenic
903281920 1:22254980-22255002 GAAACCCTGCTCCTACTGGAAGG - Intergenic
904389097 1:30169243-30169265 GGAAGGCTGGTCCTACCTGAAGG + Intergenic
904505915 1:30953807-30953829 AAAAGCCTGCTCCTGCCAGAAGG + Exonic
912683170 1:111741605-111741627 AAAAGGGTTCCCCAACTTGAAGG + Intronic
915046763 1:153023969-153023991 AAAGGGCTGCTTCTGCTTGTGGG - Intergenic
915787077 1:158624855-158624877 CCAGGGCTGCTCCTACCTGATGG - Intronic
923113975 1:230917042-230917064 AAGAGGCTGCTGCTTCATGAGGG + Intronic
1064473359 10:15660178-15660200 ACAAGGCTGGTCCTACCTGTGGG - Intronic
1071065345 10:81627032-81627054 AAAAGCTACCTCCTACTTGAAGG + Intergenic
1075996059 10:126877160-126877182 AAAAGGCACATCCTACATGACGG - Intergenic
1081217512 11:40419751-40419773 AAAAGGCTGTACCTAATAGAAGG + Intronic
1082935710 11:58654550-58654572 AAAATGCTGCTTCTGGTTGATGG + Intronic
1083741369 11:64713175-64713197 GAAGGGCGGCTCGTACTTGACGG + Exonic
1086168920 11:83813230-83813252 AAAAGGCAGGTACTACTTCAAGG + Intronic
1087135808 11:94718108-94718130 AAAAGTCTGCTATTCCTTGAAGG + Intronic
1088976990 11:114824724-114824746 AAAAGCCTGCTCATCCTTCAAGG - Intergenic
1089049117 11:115530797-115530819 CCCAGGCTGCTCCTTCTTGAGGG + Intergenic
1090121598 11:124035018-124035040 TAAAAGCAGCTCCTTCTTGATGG - Intergenic
1091374430 12:16706-16728 AAAGAGCTGCTCCCACCTGAAGG + Intergenic
1093675616 12:21936298-21936320 AAACTGCTGCTGCTACCTGAAGG + Intronic
1094435666 12:30418373-30418395 CAAAGGCTGCACAGACTTGAAGG - Intergenic
1096243231 12:49970517-49970539 GAAGGGCTGCCCCTACTTCAAGG + Intronic
1098937932 12:76501830-76501852 AAAATGCTGCCCCTTCGTGATGG - Intronic
1099099588 12:78421990-78422012 ATGAGGCTGCTACTACTTTAGGG + Intergenic
1099699969 12:86071264-86071286 AAAAGGGTCATCCTGCTTGAAGG + Intronic
1105581545 13:21701611-21701633 TAAAGGCTTCTCCTCCTGGAGGG + Exonic
1105612381 13:21980297-21980319 AAAATGCTGCTCCTACGTACAGG - Intergenic
1106120875 13:26859394-26859416 AAAAGGCACATCCTACATGATGG + Intergenic
1106950727 13:34880814-34880836 AAAAGGGGGCTCATTCTTGAAGG - Intergenic
1108864526 13:54906565-54906587 AAAAGTTTGCTCCTATTTGTTGG - Intergenic
1110004242 13:70246318-70246340 AAAAGGCTGCTCTTAAAGGATGG - Intergenic
1117565923 14:56993181-56993203 AAAAGCTTGCTCCTACCTTAGGG + Intergenic
1121992132 14:98568459-98568481 CTAGGGCTTCTCCTACTTGAAGG + Intergenic
1124352269 15:28965222-28965244 AAAAGGCTGTCCCTCCTTCATGG + Intronic
1124870717 15:33539339-33539361 AACAGGCTTCTCCTACATGAAGG - Exonic
1127170950 15:56300263-56300285 GAGAGGCTCCTTCTACTTGAGGG + Intronic
1130160777 15:81397879-81397901 GAAAGGCTGCAGGTACTTGACGG - Intergenic
1132452166 15:101974347-101974369 AAAGAGCTGCTCCCACCTGAAGG - Intergenic
1132454727 16:16274-16296 AAAGAGCTGCTCCCACCTGAAGG + Exonic
1136995934 16:35188055-35188077 AAAAGGCTGCTCCTTCTGAGAGG - Intergenic
1138109641 16:54313355-54313377 AAAAGCCTCCTCATATTTGAGGG + Intergenic
1139205179 16:65022023-65022045 AAAAGTTTGCTCTTACTTGATGG - Intronic
1141936787 16:87245171-87245193 AAAAGACTGCTTCTACTGGCTGG + Intronic
1142915296 17:3131597-3131619 GAAAGGCTTGTCCTACATGAGGG - Intergenic
1143372732 17:6450340-6450362 AAAAGGCAGCTCTGTCTTGAAGG + Exonic
1146673018 17:34755054-34755076 AGAAAGCTGCTCCTCCCTGATGG - Intergenic
1146744409 17:35314767-35314789 AAGAGGCTGGTCCCACTTGTTGG + Intergenic
1148352535 17:46951095-46951117 CAAAGGCTTCTCCAGCTTGAGGG + Intronic
1150516043 17:65810322-65810344 AAAAGGCTCCACCTACCTGCAGG - Intronic
1155027091 18:21951199-21951221 AAAAGGTAGCTTCTACTTGGGGG - Intergenic
1160657439 19:280790-280812 AAAAGGCTGCTGCAGGTTGAAGG - Intergenic
1163099849 19:15088277-15088299 AAAAGGCTGATCCTCCAGGAGGG - Intergenic
1164407499 19:27965108-27965130 AACAAGCTGCTCCTATTTGGTGG + Intergenic
1167998049 19:53422697-53422719 AAAAGGCAGCTGGTACTTGGTGG - Intronic
1168007523 19:53503291-53503313 AAAAGGCAGCTGGTACTTGGTGG - Intergenic
926977853 2:18532882-18532904 CAGACGCAGCTCCTACTTGATGG + Intergenic
927097516 2:19758724-19758746 ATAAGGATGCTGCTACTTGCAGG + Intergenic
927961900 2:27245818-27245840 AAAACACTGCTTCTACTTGAGGG - Intergenic
929630528 2:43456352-43456374 AAAAGGCTGCTACTACATCATGG + Intronic
932904525 2:75734762-75734784 AAAAGGCACTTCCTACATGACGG + Intergenic
936568383 2:113596823-113596845 AAAGAGCTGCTCCCACCTGAAGG - Intergenic
941982934 2:171479486-171479508 AAATGGCTGCTTATACTTGAGGG - Intronic
945464040 2:210145971-210145993 GAAAGGCAGCTCCTTCTTGGTGG + Intronic
945545827 2:211150197-211150219 AAAATGATGCTCCTACATGATGG - Intergenic
946121974 2:217523976-217523998 ATAAGCCTGCTCCTATTTAAGGG - Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1174722398 20:52827022-52827044 AGGAGGCTCCTCCTCCTTGATGG + Intergenic
1178390360 21:32192781-32192803 AAGAGGTTGCTCCTACGAGAGGG - Intergenic
952907462 3:38151476-38151498 AAAAGGCTGCAGCTACTTTCAGG + Intergenic
959273302 3:104242109-104242131 AAAAGACTCCTTCCACTTGAAGG - Intergenic
959273759 3:104249129-104249151 AGAAGTCTGCTCCTAATTGAAGG - Intergenic
960460261 3:117925454-117925476 AAAAGGCTGCTTGTACCTTAGGG - Intergenic
963240441 3:142997764-142997786 AATGGACTGCTCCTACTTGGTGG - Intronic
967033604 3:185631343-185631365 AAAATGCTGGGCCTACTGGATGG + Exonic
971279157 4:25227040-25227062 AAAACACTGCTGCTACTTTAGGG - Intronic
972664037 4:41146575-41146597 AAAAGCCTGCTCTTACTCCAAGG - Intronic
976418410 4:84807222-84807244 AAAAAGCTGTTCCTAATTCAAGG - Intronic
979798742 4:124879234-124879256 CCAAGGCTGTTCCTACTTCAGGG - Intergenic
979911339 4:126370145-126370167 AAAAGGCTGCTCAGATTTGATGG - Intergenic
982876160 4:160653025-160653047 AAAAGTTTGCAACTACTTGAAGG + Intergenic
983632460 4:169863207-169863229 AACAGGCTGCTGCTAGTGGACGG - Intergenic
985101549 4:186463150-186463172 AAAAGGGTGCTCTTACCTAAAGG + Intronic
985985071 5:3508675-3508697 AAGAGGCTTCTCCTACTAGATGG + Intergenic
988509108 5:31851028-31851050 AACAGCCTTTTCCTACTTGAAGG - Intronic
1000525367 5:162351187-162351209 AATAACCTGCTCCTACATGATGG - Intergenic
1001027147 5:168233803-168233825 AAAAGGCACTTCTTACTTGACGG + Intronic
1002106881 5:176883878-176883900 AAAAGGATGCTGCTAGTTGCTGG + Intronic
1002426770 5:179181274-179181296 ACAAGGTGGCTCCTAGTTGATGG - Intronic
1003443183 6:6162074-6162096 AAAAAGCGGCTCCGACTTGTGGG + Intronic
1005717409 6:28563814-28563836 AAAAGACTTTTCCTAATTGATGG + Intergenic
1006096484 6:31659657-31659679 GATAGGCTGGTCCCACTTGAGGG + Exonic
1008687222 6:53938901-53938923 CAAAGGCTGCACCTCATTGAAGG + Intronic
1010643837 6:78363530-78363552 AAAAAGGCACTCCTACTTGAAGG + Intergenic
1011778023 6:90753697-90753719 CAAAGACTGCTCCTACTTCAAGG - Intergenic
1012415510 6:99008760-99008782 AAAAGGCTGCTCCCCCTCTATGG - Intergenic
1012500893 6:99887138-99887160 AAAAGCCTGCTCCTACATAAAGG + Intergenic
1013821807 6:114162834-114162856 AAAAGAGTGCTCCAACTTCATGG - Intronic
1014744122 6:125179817-125179839 AGAAGGCAGCTCTTACTTAAAGG + Intronic
1015285669 6:131484228-131484250 GTCAGGTTGCTCCTACTTGAAGG - Intergenic
1020508984 7:9028718-9028740 ACAATGCTGCTCCTCCTTCAAGG - Intergenic
1023861184 7:44218476-44218498 AAAAGTCTGCTCCCCCTTGCGGG + Exonic
1027961310 7:84949344-84949366 AAAATGGAGCTCCTACTTCAAGG - Intergenic
1028428084 7:90713402-90713424 ATAAGCCTGCTCCTTCTTAATGG + Intronic
1030018478 7:105248183-105248205 AAAAGGTTGGTACTACTTAAAGG + Intronic
1031455607 7:121975407-121975429 TAAAAGCTGCTCATTCTTGAAGG + Intronic
1033238727 7:139659379-139659401 AAAAGGCTGCTCCTACTTGAAGG - Intronic
1033480321 7:141733966-141733988 AAAATCCTGCTTCCACTTGAGGG - Intergenic
1038899104 8:31821912-31821934 AAAAGGCTGCTCATACTGGGAGG - Intronic
1040020512 8:42736910-42736932 AAAAAGCTGTTGCTACTTGGTGG + Exonic
1044970923 8:97618885-97618907 ACAAAGCTGCTCCTAGTTGCAGG + Intergenic
1045124256 8:99072130-99072152 GAGAGGCTCCTCCTGCTTGATGG - Intronic
1046913395 8:119653536-119653558 ATTGGGCTGCTCCTACTTCAGGG - Intronic
1049884147 9:16702-16724 AAAGAGCTGCTCCCACCTGAAGG + Intergenic
1056037432 9:82621740-82621762 AAAGGGCTGCTCCTCCATGCTGG + Intergenic
1058039107 9:100284541-100284563 AACATGCTGCTCCTTCTGGAGGG - Exonic
1059746524 9:117206789-117206811 CAGAGGCTTCTCCCACTTGAGGG - Intronic
1062342335 9:136099398-136099420 AGAAGGCTGATCCTACTCGACGG + Intergenic
1192542738 X:71989031-71989053 AAGATGCAGCTCATACTTGATGG - Intergenic
1195195409 X:102493319-102493341 AAAAGGCTCCTGCAACTTTATGG - Intergenic
1200401657 X:156023454-156023476 AAAGAGCTGCTCCCACCTGAAGG - Intergenic
1200857594 Y:7956029-7956051 AAGAGGCTTCTCCTATTTGACGG + Intergenic
1201910988 Y:19133331-19133353 AAAAAGCTGCTCCTTTTTCAGGG - Intergenic