ID: 1033242429

View in Genome Browser
Species Human (GRCh38)
Location 7:139691157-139691179
Sequence CTGTGATAGTAAGGGTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242429_1033242438 0 Left 1033242429 7:139691157-139691179 CCCCCCTACCCTTACTATCACAG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56
1033242429_1033242439 16 Left 1033242429 7:139691157-139691179 CCCCCCTACCCTTACTATCACAG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242429 Original CRISPR CTGTGATAGTAAGGGTAGGG GGG (reversed) Intronic
902938846 1:19785129-19785151 ATGTGATGGTCAGGGAAGGGTGG - Intronic
903403494 1:23076615-23076637 CTATGGTGGTTAGGGTAGGGAGG - Intronic
904035801 1:27557989-27558011 CTGGGATTGTAAGGGTGGGGAGG - Intronic
905891375 1:41520585-41520607 CTGGGGTAGTCAGGGTAGGGTGG - Intronic
906535391 1:46548472-46548494 CTGGGATAGAATGGGGAGGGGGG - Intronic
906782790 1:48587167-48587189 CTGTGAAAGACAGAGTAGGGAGG + Intronic
909649277 1:77955425-77955447 ATGTGACAGTGAGGGTAGGAGGG + Intronic
910114468 1:83716904-83716926 CTGTGGTGGTGAGGGGAGGGTGG - Intergenic
911314399 1:96338764-96338786 CTGGACTAGTAAGGGTGGGGAGG - Intergenic
912122854 1:106494011-106494033 AAGTGATAGTGAGGGTAGTGAGG + Intergenic
912469631 1:109897501-109897523 CTGTGATAGTGATGTCAGGGTGG - Intergenic
912654574 1:111474370-111474392 ATGTGAAAGTTAGGGTGGGGTGG + Intronic
913387973 1:118280230-118280252 CTGTGAGAGTAAGGGCACGCAGG - Intergenic
913390250 1:118302702-118302724 GGGTGGAAGTAAGGGTAGGGAGG + Intergenic
914716615 1:150259521-150259543 CTGAGATGGTTAGGGAAGGGTGG - Intronic
915064761 1:153215702-153215724 CTGGGAGAGTAGGTGTAGGGTGG - Intergenic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915608251 1:156969036-156969058 CTGTTATATAAAGAGTAGGGTGG - Intronic
918736566 1:188071504-188071526 TTGTGACAGGAAGGGTTGGGTGG + Intergenic
919012438 1:191983035-191983057 CTGTGATAGTAGTGGTAGGATGG + Intergenic
920145887 1:203860913-203860935 TTGTGGTGGAAAGGGTAGGGCGG - Intergenic
920426429 1:205880065-205880087 CTGTGATAGACAGGGCTGGGTGG + Intergenic
920676300 1:208040845-208040867 CTGGGATGGGAAGGGGAGGGGGG - Intronic
922432572 1:225570477-225570499 CTGTCTTAGGAAGGGTAAGGTGG - Intronic
922664260 1:227455234-227455256 CTGTGGAAGGAAGGGCAGGGGGG + Intergenic
1063169946 10:3499866-3499888 CTATGATTGCAAGGGTAGGAAGG + Intergenic
1066327957 10:34384671-34384693 CTGTGAAAGTAAAGGTAATGAGG + Intronic
1068450627 10:57182330-57182352 CTGTGATGGCAAGGGTATGAAGG - Intergenic
1069762043 10:70817633-70817655 CTCTGGTAGTACGGGAAGGGAGG - Intronic
1071531597 10:86393575-86393597 CTGTGGCAGCAAGGGTGGGGCGG + Intergenic
1071584370 10:86805434-86805456 CTGAAATAGTAAGGGTAAAGGGG - Intronic
1073473343 10:103737507-103737529 GTGGGACAGTAAGGGCAGGGAGG + Intronic
1075040503 10:119103987-119104009 CTGTGATGGTCCGGGGAGGGAGG + Intergenic
1077630421 11:3807887-3807909 CAGTCATGGTCAGGGTAGGGAGG + Intronic
1078180420 11:9005665-9005687 CTGTGGGGGTAGGGGTAGGGGGG + Intergenic
1078526144 11:12103071-12103093 GTGTGAAAGTAGGGGTGGGGAGG + Intronic
1078914464 11:15765773-15765795 CTGTGAGCTTAAAGGTAGGGTGG - Intergenic
1079787346 11:24689929-24689951 CTGTAAAAATAAGGGTAGTGAGG + Intronic
1081284102 11:41246416-41246438 CTGAGCTTGTAGGGGTAGGGGGG + Intronic
1081718694 11:45270019-45270041 ATGGGAAAATAAGGGTAGGGTGG - Intronic
1081824838 11:46039244-46039266 CTGTTTTAGTATAGGTAGGGTGG + Intronic
1083730208 11:64648719-64648741 CTGTGATGGTGAGTGGAGGGTGG - Exonic
1083936400 11:65872197-65872219 CTGGGACAGGAAGGGTAGGGAGG - Intronic
1084870019 11:72092123-72092145 CAGGGAGAGTGAGGGTAGGGAGG - Intronic
1085346456 11:75771181-75771203 CTGTGGGAGTATGGGTAGGTGGG + Intronic
1088156063 11:106805203-106805225 CTGTCAGAGTAAAGGTAGAGGGG - Intronic
1088669402 11:112126954-112126976 ATGTGAGGGTAAGGGTAGGGAGG - Intronic
1092281377 12:7100206-7100228 CTGTGACAAGCAGGGTAGGGGGG + Intronic
1093341362 12:17978614-17978636 ATGGGAGAGTAAGGGTAGGAAGG - Intergenic
1096139602 12:49232086-49232108 CTGTGAAAGCAAGCGTTGGGTGG - Intronic
1098805859 12:75019790-75019812 CAGTGATAGTTGGGGCAGGGTGG + Intergenic
1107901789 13:45023756-45023778 ATGTGAAAGCAAGGGAAGGGAGG + Intronic
1113596905 13:111539995-111540017 CTGGGATGGTGAGGGTAGAGGGG - Intergenic
1113802761 13:113095034-113095056 CTATGACATAAAGGGTAGGGGGG - Intronic
1119978553 14:79053704-79053726 CTGTGATGGTAAGGGAAAAGAGG + Intronic
1123196030 14:106617499-106617521 CTGTGGTACTTAGGGAAGGGAGG + Intergenic
1124159637 15:27256478-27256500 CTCTTATGTTAAGGGTAGGGGGG + Intronic
1124990998 15:34673751-34673773 CAGTGATAGTAGGGGTAGAAAGG - Intergenic
1125388981 15:39171806-39171828 CTTTGATGGAAAGGGGAGGGGGG - Intergenic
1132909735 16:2303148-2303170 CTATGACAGTAAGTGTAGAGAGG + Intronic
1141592825 16:85079999-85080021 CTGTGATCTTCAGGGGAGGGAGG - Intronic
1144779170 17:17799317-17799339 CTGTGATAGTCAGTGCAGAGGGG + Intronic
1147413648 17:40272664-40272686 ATTTGGTAGTAAGGGAAGGGGGG + Intronic
1149536884 17:57440126-57440148 CTGTGCTTGAAAGGGTGGGGAGG + Intronic
1151997758 17:77620994-77621016 CTGTGGTAGGGAGGGCAGGGTGG + Intergenic
1153104629 18:1512027-1512049 CTGTTAGAGTAAGGGAAGGGAGG - Intergenic
1153656890 18:7290769-7290791 CTGTAATAATATGGGTAGAGAGG - Intergenic
1157093888 18:44668733-44668755 CTGTGAGAGTAAATCTAGGGTGG - Intergenic
1157395067 18:47334617-47334639 CTGTGACAGTTAGAGGAGGGAGG + Intergenic
1158894751 18:61902309-61902331 CTGTGAGAGTGAGGATAAGGAGG - Intergenic
1167015790 19:46840085-46840107 CTGTGATAGGCAGTGTGGGGAGG + Intronic
926874680 2:17462121-17462143 CTGTGATAGCATGGGGAGAGGGG + Intergenic
927062536 2:19437208-19437230 CTGTGATACTAAGGGGGAGGAGG - Intergenic
929486301 2:42357948-42357970 CTGTGAGAGTGAAGGAAGGGAGG - Intronic
931908798 2:66871539-66871561 CTGTGATAGTAGGGGAAGAGGGG + Intergenic
932431028 2:71673573-71673595 CTATGACAGCCAGGGTAGGGTGG + Intronic
933591673 2:84239855-84239877 CTGTGTTAGTCAAGGTAGGTTGG + Intergenic
941399647 2:165014969-165014991 CTGGGAGATTGAGGGTAGGGGGG + Intergenic
1172515468 20:35529744-35529766 GTGTCAGAGAAAGGGTAGGGTGG - Intergenic
1173492302 20:43492957-43492979 CTGAGATAGTGAGGGTGGAGAGG + Intergenic
1177309335 21:19368726-19368748 CTGTGATAGTAAAGGGTTGGTGG - Intergenic
1179366773 21:40765981-40766003 CTGTGATAGCAGGGGTAAGAGGG - Intronic
950821645 3:15766313-15766335 CTGTGATAATAAGGAAAGGTGGG + Intronic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
966732006 3:183159222-183159244 CTATGAGAGTGTGGGTAGGGTGG + Intronic
967152633 3:186663838-186663860 CTGGGATGGTAATGGTTGGGAGG - Intronic
969124336 4:4935352-4935374 CTGAGATTGGAAGGGTAGGCAGG - Intergenic
969231978 4:5838433-5838455 CTGTGATGGGTAGGGTGGGGTGG + Intronic
970249472 4:14098997-14099019 CTATGGTATTCAGGGTAGGGAGG + Intergenic
970408408 4:15785188-15785210 CTGTGGAAGGAAGGGTAGAGTGG + Intronic
973771352 4:54209931-54209953 CTGAGATAGGAGGGGTAGGGAGG + Intronic
973876564 4:55225823-55225845 CTGAGATAGGAAAGGTAGGCTGG - Intergenic
975459735 4:74636927-74636949 GTGTGGTAGTAGGGGTGGGGAGG - Intergenic
975831169 4:78370540-78370562 GTGTGATAGAAAGGGAATGGTGG - Intronic
975973943 4:80073513-80073535 TTGTGGTAGTAGGGGTGGGGTGG - Intronic
978696942 4:111593069-111593091 GTGTGATATTAAGAGGAGGGGGG + Intergenic
986060087 5:4179847-4179869 CTGGGATAGTAAGGAGATGGTGG - Intergenic
989792315 5:45420507-45420529 GTGTAATAGTTAGGGTGGGGAGG + Intronic
991732653 5:69604240-69604262 TTGTCATAGTAAGATTAGGGTGG + Intergenic
991862300 5:71023612-71023634 TTGTCATAGTAAGATTAGGGTGG - Intronic
992614122 5:78533460-78533482 CTGTGAGAGTAGGGGATGGGCGG + Intronic
993846682 5:92953280-92953302 CTGTGGTAGTAGAGGTAGGTTGG + Intergenic
995100505 5:108295987-108296009 CAGTGCTAGTAAGAATAGGGTGG + Intronic
999957549 5:156718986-156719008 CTGTGACATCAAGGGTAAGGAGG - Intronic
1005684945 6:28245331-28245353 CTGGGAAAGTCAGGGTAGGACGG - Exonic
1006437301 6:34032745-34032767 CAGAGATTGAAAGGGTAGGGAGG + Intronic
1007872003 6:45051084-45051106 CTGTGTTAGTCAGGATAGGATGG + Intronic
1011303496 6:85901133-85901155 CTCTGCTAGTAAAGGTAGGTTGG + Intergenic
1012592233 6:100996347-100996369 CTGTTAAAGAAAGGGTAGGATGG - Intergenic
1012833622 6:104237647-104237669 CTGTGATAGGGATGGTGGGGGGG - Intergenic
1012846863 6:104401029-104401051 CTGTGCTAGGAAGGGAGGGGAGG - Intergenic
1013031968 6:106342617-106342639 CTGTGATAGAAAATGTAGGGGGG + Intergenic
1013677963 6:112488205-112488227 CTGTGATAGGAAAGGGAGGAAGG - Intergenic
1015905122 6:138108356-138108378 ATGTGACAGGAAGGGTGGGGTGG + Intergenic
1017835223 6:158171103-158171125 CTGTGATGGCAAGGCTAAGGAGG + Intronic
1019629582 7:2041187-2041209 CTGTGCTAGGAAGGGGAGGCAGG - Intronic
1020349981 7:7208820-7208842 CTGTGGGAGTGAGGGTGGGGTGG + Intronic
1020511558 7:9063113-9063135 GTATGATAGAAAGGGGAGGGAGG + Intergenic
1021025140 7:15657868-15657890 CTGTGATAGTGAGGGAATGAGGG + Intronic
1025706068 7:63865359-63865381 CTGTGATCGTTGGGGTATGGAGG + Intergenic
1031971171 7:128066172-128066194 GTGGGATGGTAGGGGTAGGGGGG - Intronic
1033242429 7:139691157-139691179 CTGTGATAGTAAGGGTAGGGGGG - Intronic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1041469902 8:58197110-58197132 CTGAAATAGGGAGGGTAGGGAGG + Intronic
1041790954 8:61695579-61695601 CTGTGAGAGTAAGGGAAGTGAGG - Intronic
1044466420 8:92512202-92512224 CAGTGATACGAAGGGCAGGGTGG - Intergenic
1045316880 8:101051211-101051233 CAGGGATAGTGAGGATAGGGAGG + Intergenic
1047814135 8:128444436-128444458 TTCTGATAGTAAGGTTTGGGGGG + Intergenic
1051160433 9:14201313-14201335 CTGTGAGAGTGAGGCTAGGCTGG - Intronic
1051609280 9:18945612-18945634 CTGTTATAGTGAAGGTAAGGAGG - Intronic
1052679729 9:31673982-31674004 CAGTGAGAGAAAAGGTAGGGAGG - Intergenic
1055711670 9:79069273-79069295 CTGTGGTACTGAGGATAGGGAGG + Intergenic
1056141078 9:83680490-83680512 CCAAGAAAGTAAGGGTAGGGAGG + Intronic
1059249217 9:112873070-112873092 CTGTGTTAGAAAGGTTGGGGTGG + Exonic
1059847233 9:118293801-118293823 CTGTCCTAGAAAGGGTCGGGGGG + Intergenic
1185522821 X:754480-754502 CTTTGATTGTAACTGTAGGGAGG + Intergenic
1187432763 X:19239923-19239945 CTATTATAGTGAGGGGAGGGGGG - Intergenic
1196911444 X:120488317-120488339 CTGTGAAAGGAAGGGGTGGGAGG + Intergenic
1197217752 X:123882411-123882433 CTGTGAGGGGAAGGGTAGAGAGG - Intronic
1197313249 X:124931835-124931857 CAGAGATTGTAAGGGGAGGGAGG + Intronic
1198087390 X:133293936-133293958 TTGTAAGAGTAAGGGCAGGGAGG - Intergenic
1198845654 X:140907613-140907635 ATGTGAGAGTAAGAGTAGGATGG - Intergenic