ID: 1033242430

View in Genome Browser
Species Human (GRCh38)
Location 7:139691158-139691180
Sequence ACTGTGATAGTAAGGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242430_1033242439 15 Left 1033242430 7:139691158-139691180 CCCCCTACCCTTACTATCACAGT 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242430_1033242438 -1 Left 1033242430 7:139691158-139691180 CCCCCTACCCTTACTATCACAGT 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242430 Original CRISPR ACTGTGATAGTAAGGGTAGG GGG (reversed) Intronic
901765251 1:11495864-11495886 ACTGTAATAGGCAGGGGAGGAGG - Intronic
906697830 1:47836681-47836703 ACTGTGATAGTATTTCTAGGTGG + Intronic
907831916 1:58072436-58072458 ACTGTCATAGAGATGGTAGGTGG - Intronic
909649276 1:77955424-77955446 AATGTGACAGTGAGGGTAGGAGG + Intronic
910768662 1:90808754-90808776 ACTGTGATTGTAAGAGTAATCGG - Intergenic
910904574 1:92161706-92161728 ACTGTGTTAGTAAGAGTATATGG + Intergenic
919977982 1:202625422-202625444 ACTGGGAGTGTAAGGGGAGGGGG + Intronic
920303419 1:205003467-205003489 TCTGTGCTAGTAGGGGTAGCTGG + Intronic
920763762 1:208811407-208811429 ACTGAGATTGAAAGTGTAGGTGG - Intergenic
921254833 1:213329870-213329892 TATGTGAAAGGAAGGGTAGGAGG - Intergenic
922616095 1:226962011-226962033 AGTGTGATAGTATTGGGAGGTGG - Intronic
923942242 1:238841202-238841224 ACTGAAATTGTAATGGTAGGTGG - Intergenic
924316531 1:242803546-242803568 AATGGGATAGTATGTGTAGGTGG - Intergenic
1063012269 10:2035666-2035688 GGTGTGATAGGAAGGGTTGGGGG + Intergenic
1064799859 10:19057476-19057498 AATGTGATAGTATTGGAAGGTGG - Intronic
1066488887 10:35875083-35875105 ACTGTCATAGTAAGGATATGGGG + Intergenic
1067308966 10:45094389-45094411 ACTGTCGTAGTAAGAATAGGGGG + Intergenic
1069074965 10:64029681-64029703 GTTGTGATAGTAATGGGAGGAGG - Intergenic
1069792067 10:71029200-71029222 ACTGTGGTTGCAAGGGTTGGTGG + Intergenic
1071132922 10:82416697-82416719 ACTGAGATGGTCAGGGTGGGTGG - Intronic
1071430192 10:85601200-85601222 ACTCTGTTAGTAAGAGTTGGGGG - Exonic
1071584371 10:86805435-86805457 ACTGAAATAGTAAGGGTAAAGGG - Intronic
1072478765 10:95789857-95789879 ACTGTAATAGCAAGAGGAGGTGG - Intronic
1074537384 10:114338237-114338259 ACTGTGATGGCCAGGGCAGGTGG + Intronic
1075360936 10:121833150-121833172 ACTCTGATAGCAAAGGGAGGTGG - Intronic
1077771898 11:5227958-5227980 ACTTAGAAAGTAGGGGTAGGAGG + Intronic
1078445206 11:11399063-11399085 AATGTGATAGTAATAGAAGGTGG + Intronic
1079780889 11:24602850-24602872 ACAGTGAGATTAAGGGAAGGTGG + Intronic
1085346455 11:75771180-75771202 GCTGTGGGAGTATGGGTAGGTGG + Intronic
1085880353 11:80460212-80460234 ATTTTGTGAGTAAGGGTAGGAGG - Intergenic
1087424837 11:97972808-97972830 ACTGTGATAGGAAAGCTTGGAGG + Intergenic
1088525067 11:110744042-110744064 ACTGTTGTAGACAGGGTAGGGGG - Intergenic
1090313175 11:125761156-125761178 AGTGGGATGGTAAGGGTGGGAGG + Intergenic
1091497937 12:988860-988882 AGTGTGATAGTATTGGGAGGTGG - Intronic
1092281376 12:7100205-7100227 ACTGTGACAAGCAGGGTAGGGGG + Intronic
1098591489 12:72219114-72219136 AATGTGATAGTAATAGTAGATGG + Intronic
1101725541 12:107385512-107385534 ACTGGGATCGTCAGGGTTGGGGG + Intronic
1114414668 14:22533491-22533513 ACTGTGATACTCACGGGAGGAGG + Intergenic
1115470126 14:33760075-33760097 ACTGAGATGGGAAGGGCAGGTGG - Intronic
1117150004 14:52876806-52876828 ACTGTGAAAGTATGGTGAGGAGG - Intronic
1117575780 14:57095751-57095773 ACTGTGACAGTATTGGGAGGTGG - Intergenic
1127640812 15:60914253-60914275 ACTGCGAGAGAAAGGGTGGGAGG + Intronic
1129323262 15:74786514-74786536 GCTGGGAGATTAAGGGTAGGGGG + Intronic
1131848007 15:96508778-96508800 ACAGGGATAGAAAGGGTGGGAGG - Intergenic
1132120735 15:99173135-99173157 ACTGGCAGAGTAAGGGGAGGTGG - Intronic
1133693574 16:8239135-8239157 ACTGTGAAAGTCAGGCTAAGGGG + Intergenic
1134236952 16:12474086-12474108 ACTGTGATAGAAAGTGTTAGAGG + Intronic
1136080498 16:27849418-27849440 ACAGTGATTGTAAGGGGAGGAGG + Intronic
1136475714 16:30511934-30511956 TCTGTAATGTTAAGGGTAGGGGG + Intronic
1137950889 16:52782290-52782312 AGTGGGATAGGAAGGGTTGGAGG - Intergenic
1138389193 16:56657944-56657966 GCTTTGATAGTCAGGGGAGGGGG - Exonic
1140507354 16:75482179-75482201 ACTGGGATTGGAAGAGTAGGTGG - Intronic
1140514479 16:75532206-75532228 ACAGGGATTGGAAGGGTAGGTGG - Intronic
1140694714 16:77521321-77521343 AATGTGATAGTAATAGAAGGTGG - Intergenic
1141432834 16:83979731-83979753 ACTGTGAGAGTACGTGTGGGTGG + Intronic
1143255927 17:5558061-5558083 ACGGTCATTCTAAGGGTAGGAGG + Intronic
1143389562 17:6552315-6552337 ACTGAGAGAATGAGGGTAGGGGG - Intronic
1143524001 17:7462165-7462187 ACTGAAGTTGTAAGGGTAGGCGG + Exonic
1148497187 17:48059965-48059987 CCTGTGAGAGGAAGGGAAGGTGG + Exonic
1149003090 17:51777165-51777187 ACTGCGATAGGAAGGATGGGAGG + Intronic
1154939373 18:21095672-21095694 ACAGAGATAGGAAGGGTAGTAGG + Intronic
1155159594 18:23184946-23184968 ACTGTGATAGTATGAGGTGGTGG - Intronic
1155244499 18:23894439-23894461 TCTGGGAAAGTAAGGGTGGGAGG + Intronic
1156098326 18:33562957-33562979 ACTGTGTAAACAAGGGTAGGAGG + Intergenic
1160063362 18:75551783-75551805 ACTGAGAAAGTAAGTGTATGTGG + Intergenic
1166864163 19:45826067-45826089 GCTGTGGGAGTCAGGGTAGGGGG - Intronic
1167642703 19:50690561-50690583 ACTGGGATTGTGAGGGTGGGAGG - Intronic
926467754 2:13212890-13212912 AGTGTGAAAGAAAGGGAAGGAGG + Intergenic
926874679 2:17462120-17462142 ACTGTGATAGCATGGGGAGAGGG + Intergenic
927566718 2:24119902-24119924 ACTGTTATAATAATGGTAGATGG + Intronic
927989113 2:27435080-27435102 ACTGGGAAATTAAGGGCAGGGGG - Intronic
929099180 2:38292746-38292768 ACTTTGATTCTTAGGGTAGGTGG - Intergenic
929408655 2:41671797-41671819 ATTGTGATGGTATGTGTAGGTGG - Intergenic
931908797 2:66871538-66871560 ACTGTGATAGTAGGGGAAGAGGG + Intergenic
932548633 2:72743003-72743025 GCTGTGATGGGATGGGTAGGCGG - Intronic
935255492 2:101306664-101306686 ACTGTGGGAGTATGGGTTGGTGG - Intronic
939735963 2:145845621-145845643 GCTGTGATGGTAATGGAAGGAGG - Intergenic
939954867 2:148519333-148519355 ACTGTTATATTGAGTGTAGGAGG - Intergenic
940028630 2:149236363-149236385 CCTGTGAGAGGAAGGGCAGGGGG + Intergenic
941249684 2:163146892-163146914 ACTGTGTAGGTAAGGGTATGAGG - Intergenic
941413020 2:165183985-165184007 ACTATTATAGTAAGGGTATAAGG + Intronic
944638539 2:201698192-201698214 ACAAGCATAGTAAGGGTAGGGGG - Intronic
944777768 2:202985344-202985366 ACTGTTATAGTAGAGGTAGGTGG + Exonic
945212586 2:207398913-207398935 ACTGCTATAATAAGGGTAAGAGG + Intergenic
946290747 2:218743196-218743218 GATGGGAGAGTAAGGGTAGGAGG - Intronic
1172130754 20:32653139-32653161 ACTGTGAATTTAAGGGTGGGTGG + Intergenic
1179366774 21:40765982-40766004 GCTGTGATAGCAGGGGTAAGAGG - Intronic
1182433617 22:30315895-30315917 ACTGGGACAGGAAGGGGAGGAGG + Intronic
949360077 3:3222185-3222207 ACTGTGATTTTCAGGGGAGGTGG + Intergenic
950821644 3:15766312-15766334 CCTGTGATAATAAGGAAAGGTGG + Exonic
951250169 3:20385287-20385309 ACTATGAAAGAAAGTGTAGGTGG + Intergenic
952866355 3:37857773-37857795 ATTGGGATACCAAGGGTAGGGGG - Intergenic
955442881 3:58976273-58976295 AAAGTGAAAGTAAAGGTAGGTGG + Intronic
956011025 3:64831929-64831951 ACTGTGAGAGTCCTGGTAGGGGG - Intergenic
957855271 3:85867888-85867910 AATGTGAAAGTAAGGCAAGGTGG - Intronic
959823280 3:110762678-110762700 ACTGTGATAGTATTAGAAGGTGG - Intergenic
962428628 3:135298514-135298536 ACTGTGCAAGTGATGGTAGGAGG + Intergenic
968380760 4:94009-94031 ACTGTGATTGTAAGAGTCTGAGG - Intergenic
973097270 4:46217872-46217894 AGTGTGATAGTATTGGGAGGTGG - Intergenic
978696941 4:111593068-111593090 AGTGTGATATTAAGAGGAGGGGG + Intergenic
981036535 4:140175347-140175369 ACTTTGAAAGTAAGAGTAGAAGG + Intergenic
983609571 4:169627639-169627661 ACTGAGATAGGAAAAGTAGGAGG + Intronic
986415213 5:7521106-7521128 ACTGTAAAAGTAATGGTAGCAGG + Intronic
986441245 5:7783729-7783751 AATGTGATAGTGAGGATTGGGGG + Intronic
988204714 5:28118961-28118983 ACTAAGATAGAAAGGGTTGGGGG + Intergenic
989055438 5:37361857-37361879 AATGTGATAGTATTTGTAGGTGG + Intronic
990288829 5:54328240-54328262 ACTGTGAAAGTCAATGTAGGAGG - Intergenic
991932391 5:71766480-71766502 ACAGTGATGGAAAGGGAAGGGGG - Intergenic
991948567 5:71925899-71925921 ACAGAGAGAGTCAGGGTAGGAGG + Intergenic
992840009 5:80679389-80679411 AAGGTGATAGTAGGGGTAGGTGG - Intronic
993261703 5:85665787-85665809 ACTGCAATAGTAATGGGAGGTGG - Intergenic
993262057 5:85670246-85670268 ACAGTTATATTAAGGGTAGATGG - Intergenic
993882505 5:93379554-93379576 ACTATGAGAGTAGGGGTTGGGGG + Intergenic
994161573 5:96562480-96562502 ATTGTGATAGTAAGGGTGTGGGG + Intronic
995911442 5:117192580-117192602 ACTGTGATAGAGAGGAAAGGAGG - Intergenic
996290519 5:121846685-121846707 ATTATTATAGTAAGGGTAGAGGG + Intergenic
997618384 5:135268894-135268916 CCAGTGCTAGTAAGGGTATGGGG - Intronic
999869514 5:155734564-155734586 AATGCAATAGTAAGGGTATGGGG - Intergenic
1012833623 6:104237648-104237670 ACTGTGATAGGGATGGTGGGGGG - Intergenic
1013031967 6:106342616-106342638 TCTGTGATAGAAAATGTAGGGGG + Intergenic
1015175732 6:130306090-130306112 AGTGTGATAGTATTGGAAGGTGG - Intronic
1018090306 6:160340737-160340759 ACTGTGAGATAAAGGGTACGTGG - Intergenic
1021025139 7:15657867-15657889 GCTGTGATAGTGAGGGAATGAGG + Intronic
1029055400 7:97735161-97735183 ACAGTGAAAGTAAGCTTAGGGGG - Intronic
1030714778 7:112794622-112794644 AGTGTCAAAGTAAGGGTGGGGGG - Intergenic
1031756636 7:125652103-125652125 ACAGAGATAGTAATGGGAGGGGG - Intergenic
1033242430 7:139691158-139691180 ACTGTGATAGTAAGGGTAGGGGG - Intronic
1033589017 7:142795518-142795540 ACAGTGATGGTAATGGTGGGGGG - Intergenic
1033841953 7:145386124-145386146 GCTGTGATAGTAGTGGTAGTGGG + Intergenic
1036095141 8:5715786-5715808 CCTGTGAAAGCAAGGGAAGGAGG + Intergenic
1038736409 8:30173821-30173843 ACTCTGAAAGTAAGGGAGGGTGG - Intronic
1041728599 8:61042574-61042596 AATGTGATAGTATTGGGAGGTGG - Intergenic
1044271801 8:90253293-90253315 ACTGTGGGAGTTATGGTAGGAGG + Intergenic
1047756459 8:127922688-127922710 ACAGTGGTAGGAAGGGAAGGCGG + Intergenic
1047814134 8:128444435-128444457 ATTCTGATAGTAAGGTTTGGGGG + Intergenic
1053082438 9:35187840-35187862 ACTGTGTAGGTAAGGGTATGAGG + Intronic
1054822719 9:69539669-69539691 ACTGTGAAAATAAGGACAGGAGG - Intronic
1056319132 9:85420145-85420167 AATGTAAGAGTAAGGGGAGGTGG + Intergenic
1059072405 9:111152748-111152770 ACTGTAGTAGTAAGAGGAGGAGG + Intergenic
1194432447 X:93826307-93826329 CCTGTGAAAGTTAGGGTAGAAGG - Intergenic
1196224687 X:113151980-113152002 AATGTGATAGTATGAGGAGGTGG + Intergenic
1197313510 X:124935471-124935493 AGTGTGATAATAACAGTAGGAGG - Intronic
1197925939 X:131647091-131647113 ACTCTGATAATAGGGGTATGGGG - Intergenic