ID: 1033242431

View in Genome Browser
Species Human (GRCh38)
Location 7:139691159-139691181
Sequence CACTGTGATAGTAAGGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242431_1033242439 14 Left 1033242431 7:139691159-139691181 CCCCTACCCTTACTATCACAGTG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242431_1033242438 -2 Left 1033242431 7:139691159-139691181 CCCCTACCCTTACTATCACAGTG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242431 Original CRISPR CACTGTGATAGTAAGGGTAG GGG (reversed) Intronic
900328359 1:2122069-2122091 CACGGTGGTAGTTAGGGTCGTGG + Intronic
900328794 1:2123694-2123716 CACGGTGGTAGTTAGGGTGGTGG + Intronic
901550198 1:9990291-9990313 CACTGTGACTGGAAGTGTAGAGG - Intergenic
906269098 1:44460316-44460338 CACTGAAGTAGTAAGGGCAGGGG + Intronic
911552979 1:99306569-99306591 CAGTGGGATAGTGAGGGTTGAGG + Exonic
914680232 1:149933830-149933852 CAGTGTGATGGTTAGGGTAATGG - Intronic
915415183 1:155736461-155736483 TACTGTGACAGTATGTGTAGTGG + Intronic
918165839 1:181947010-181947032 CACTCAGATATTAAGGGTGGGGG - Intergenic
919011441 1:191970325-191970347 CTCTGTTCTAGTAAGGGAAGAGG + Intergenic
920546757 1:206824627-206824649 CACAGAGCTAGTAAGAGTAGGGG + Intronic
923696088 1:236253964-236253986 AACTGTAATAGTGAGGCTAGCGG + Intronic
923820525 1:237435175-237435197 CACAGTGAAAATAAAGGTAGAGG + Intronic
924405761 1:243744279-243744301 CATAGTGACTGTAAGGGTAGAGG + Intronic
1063447712 10:6130116-6130138 CACTGTGATGGGAAGGGCACAGG - Intergenic
1066488886 10:35875082-35875104 TACTGTCATAGTAAGGATATGGG + Intergenic
1066629666 10:37446743-37446765 CAGTGTGATAGTCACGGTGGAGG + Intergenic
1067036608 10:42925597-42925619 CACTGTGCTTGTGAGAGTAGTGG - Intergenic
1068219057 10:54020185-54020207 CACAGTGATTGTAAAGGTAAGGG - Exonic
1068895775 10:62199003-62199025 CACTTTGGTAATAAGGGTGGTGG + Intronic
1068910022 10:62369252-62369274 GACTGTGAAAGGAAGGGTGGTGG - Intergenic
1069016744 10:63438373-63438395 CATGGTGATAGCAATGGTAGAGG - Intronic
1070916177 10:80156365-80156387 CACTCTTAGAGTAAGTGTAGTGG - Intronic
1071584372 10:86805436-86805458 AACTGAAATAGTAAGGGTAAAGG - Intronic
1073959301 10:108908003-108908025 CACTGTGTTGGTAGTGGTAGCGG - Intergenic
1085031110 11:73271337-73271359 CACTGAGATAGTGAAGGGAGTGG + Intronic
1085079700 11:73624148-73624170 CAGTGTGATAGGCAGGGGAGGGG + Intergenic
1085093551 11:73739857-73739879 CACTGTGTTAGCCAGGGTGGTGG - Intronic
1088156065 11:106805205-106805227 CTCTGTCAGAGTAAAGGTAGAGG - Intronic
1089345427 11:117788248-117788270 CACTGTGATGGGGAAGGTAGTGG - Intronic
1090966529 11:131602296-131602318 AACTGTGTTAGTAAGGACAGGGG + Intronic
1096384706 12:51187506-51187528 CACTGTGGGAGGAAGGGCAGAGG + Exonic
1098859036 12:75687012-75687034 AAGTGTGATAGGAAGGGTAACGG - Intergenic
1101478428 12:105073754-105073776 CGCTGTGATAGTAGGGGCTGAGG + Intronic
1103791947 12:123478336-123478358 CCCTGGAATAGTAAGGGAAGGGG - Intronic
1106760587 13:32863665-32863687 AAATGTGATACTAAGTGTAGAGG + Intergenic
1108934289 13:55866829-55866851 CACTGTCATACTAGGGGGAGTGG + Intergenic
1109430418 13:62226452-62226474 CACTGTCATATTAGGGGTTGTGG - Intergenic
1110555258 13:76852569-76852591 CACTGTGATATTGAGGGTAAAGG + Intergenic
1113596907 13:111539997-111540019 CGCTGGGATGGTGAGGGTAGAGG - Intergenic
1114724547 14:24921825-24921847 AAATGTGAAAGTAAGGGTTGTGG - Intronic
1115241715 14:31256552-31256574 CAGTTTAAGAGTAAGGGTAGGGG + Intergenic
1115489828 14:33948602-33948624 CACTGTGTAAGTTAGGGTAAGGG - Intronic
1119992227 14:79211864-79211886 TACTGTAACAGTGAGGGTAGGGG - Intronic
1121272344 14:92646315-92646337 CATTGGGATAGGCAGGGTAGTGG + Intronic
1124420956 15:29521466-29521488 CACTGTAAAAATAAGGATAGAGG + Intronic
1125042906 15:35212484-35212506 CTCTGTGATACAAAGGGCAGGGG + Intergenic
1126386511 15:48099068-48099090 CAATGTGATAATAAGAGGAGGGG - Intergenic
1135091007 16:19517411-19517433 CACTGTGAAAGTAAGAAGAGTGG - Intronic
1142329922 16:89445242-89445264 CAATGTATTAGTAAGGGAAGGGG + Intronic
1143389563 17:6552316-6552338 CACTGAGAGAATGAGGGTAGGGG - Intronic
1144527531 17:16002885-16002907 AACTGTAATAGTAAGAGTACAGG + Intronic
1144779167 17:17799315-17799337 CCCTGTGATAGTCAGTGCAGAGG + Intronic
1153123847 18:1765329-1765351 CACTATGACAGTAAGGTGAGGGG - Intergenic
1153561000 18:6371563-6371585 CTCTGTGGTAGTAAGGGTTTTGG - Intronic
1153890662 18:9511529-9511551 CATTATGATGGTAAGGATAGAGG - Intronic
1158863785 18:61618166-61618188 CACTGAGATAGTGAAGGGAGTGG - Intergenic
1160199652 18:76786052-76786074 CACAGGGACAGTAAGGGCAGTGG + Intergenic
1168370470 19:55829465-55829487 CACTGTGTTAGCCAGGATAGGGG - Intronic
926874678 2:17462119-17462141 AACTGTGATAGCATGGGGAGAGG + Intergenic
927620092 2:24646288-24646310 CATTGTCATCGTAATGGTAGAGG - Intronic
927989114 2:27435081-27435103 CACTGGGAAATTAAGGGCAGGGG - Intronic
928110209 2:28501605-28501627 AAATGGGATAGAAAGGGTAGGGG - Intronic
931908796 2:66871537-66871559 AACTGTGATAGTAGGGGAAGAGG + Intergenic
932263292 2:70344849-70344871 CACTGTGGTACTAGGGGTTGGGG + Intergenic
933658725 2:84909348-84909370 CATGGTGATGGTAATGGTAGTGG - Intergenic
934234855 2:90221501-90221523 CACTCTGATGGTATTGGTAGAGG + Intergenic
934690785 2:96357251-96357273 CCCTGTGATATTATGGGGAGGGG + Intronic
938488412 2:131740173-131740195 CTCTGTGAGAGAAGGGGTAGAGG + Intronic
941657201 2:168156947-168156969 CACTTTGATGGGGAGGGTAGGGG - Intronic
942796551 2:179827258-179827280 CAGTGTGATAGGGAGGGTTGGGG + Intronic
945571732 2:211476372-211476394 CACTGGGATATTTTGGGTAGGGG + Intronic
946450045 2:219771908-219771930 CACTGTGATAACACTGGTAGGGG - Intergenic
947956220 2:234194425-234194447 CATTGTCATAGTGATGGTAGGGG + Intergenic
1173415774 20:42854482-42854504 CACTGTGACAGAATGGGTGGGGG + Intronic
1177231738 21:18330537-18330559 TACTGTTATAATAAGGGTAAAGG - Intronic
1177421685 21:20867483-20867505 TAGTGGTATAGTAAGGGTAGTGG - Intergenic
1177629838 21:23712137-23712159 CACTGTGGGAGGCAGGGTAGTGG - Intergenic
1178579784 21:33828683-33828705 CACTTGGAGAGCAAGGGTAGAGG + Intronic
1179650822 21:42807457-42807479 CACTGAGATAGTGAAGGGAGTGG + Intergenic
1180663937 22:17494631-17494653 CAGTGAGATAGTAAGAGTAGGGG + Intronic
1183540968 22:38429255-38429277 CAATGTGACAGTCAGGGTGGAGG + Intronic
1183721574 22:39565812-39565834 CATTGTGGTGGTAAGGGTAATGG + Intergenic
950460777 3:13121088-13121110 GACTGTGATAGTCAGGGCCGAGG - Intergenic
952192259 3:31036097-31036119 CCTTGTTATAGTAAGGGTAAAGG + Intergenic
952595433 3:35011970-35011992 CACTGTGATAGTAAGGCAATGGG - Intergenic
953966595 3:47312137-47312159 CACAGTGGTAGTATGGGCAGGGG + Intronic
955759499 3:62263542-62263564 TGCTTTGATACTAAGGGTAGGGG + Intronic
956011026 3:64831930-64831952 CACTGTGAGAGTCCTGGTAGGGG - Intergenic
957396938 3:79652670-79652692 CACAGTGATATTAATAGTAGTGG + Intronic
957704692 3:83765360-83765382 CACTGTGATAGTTACTATAGTGG - Intergenic
957818156 3:85330327-85330349 AAGTGTGATATTAATGGTAGAGG - Intronic
958984224 3:100761632-100761654 CACTGTGAAAGGAAAGGTAGGGG + Intronic
961251227 3:125507431-125507453 CACTGTGGTAGTAAGGAGAGGGG + Intronic
961619465 3:128212321-128212343 CACTCTGGTACTAAAGGTAGTGG - Intronic
965044622 3:163560598-163560620 CATTGTGTGAGTAAGGGAAGGGG + Intergenic
965615645 3:170589527-170589549 CACTGTGATAGCCTGGCTAGAGG + Intronic
969218402 4:5742467-5742489 AACTGTGATAGTAATAGTGGTGG - Intronic
970486045 4:16525848-16525870 CACTGAGATAGAAAGAATAGTGG + Intronic
972263982 4:37440831-37440853 CACTTTGACACTAAGGGAAGAGG - Intronic
972364846 4:38364817-38364839 CATTGTGGGAGTAAGGGCAGAGG - Intergenic
975740908 4:77427957-77427979 CAATGTGATACTAAGGGGTGGGG - Intronic
987457043 5:18160503-18160525 CACTGTGATAATAAGTGTTATGG + Intergenic
992051887 5:72948690-72948712 CTCTCTGAAAGGAAGGGTAGTGG - Intergenic
992100268 5:73401037-73401059 CACTGTGATCCTAAGGGCAGAGG - Intergenic
994161572 5:96562479-96562501 CATTGTGATAGTAAGGGTGTGGG + Intronic
995327157 5:110903796-110903818 GACTGTGAAACTAAGGGAAGTGG + Intergenic
996290518 5:121846684-121846706 CATTATTATAGTAAGGGTAGAGG + Intergenic
997618386 5:135268895-135268917 CCCAGTGCTAGTAAGGGTATGGG - Intronic
999318104 5:150596998-150597020 GGCTGTGATAGTGAGGGTTGGGG + Intergenic
999481738 5:151954623-151954645 CACTGAGATAGTAAGAGAAGAGG - Intergenic
999723333 5:154415278-154415300 TACTGTGAGGGTAAGGATAGGGG + Intronic
999869515 5:155734565-155734587 CAATGCAATAGTAAGGGTATGGG - Intergenic
1000437496 5:161230954-161230976 CACTGTGATATTAAGGACATAGG - Intergenic
1001656466 5:173354706-173354728 CACTGTAATAGTTAGGTAAGAGG - Intergenic
1004952559 6:20690481-20690503 CACTGCGGTAGTAAGGCTAATGG - Intronic
1006057197 6:31394032-31394054 CACTGTGCTAAGAAGGGAAGAGG + Intergenic
1006609511 6:35285699-35285721 CACTGTCATAGTGAGGGATGAGG + Intronic
1006761798 6:36468871-36468893 CACTTTGATAGGATGGATAGAGG - Intronic
1007624530 6:43236776-43236798 CACTATAAAAGTAAGGGCAGTGG - Intergenic
1007946724 6:45833732-45833754 CCCTGTCATAGTAGGGGGAGTGG - Intergenic
1011314564 6:86017158-86017180 CAATGTCATATTAAGGGTAAGGG + Intergenic
1013031966 6:106342615-106342637 CTCTGTGATAGAAAATGTAGGGG + Intergenic
1013644629 6:112124165-112124187 CAGAGTGAGAGTGAGGGTAGAGG + Intronic
1018634198 6:165846549-165846571 CACTGTGATGGGAAGGGCTGAGG - Intronic
1019879080 7:3842385-3842407 CACTGTGCTGGTATGGGTAGTGG + Intronic
1021673466 7:23056928-23056950 CTGTATGATAGTAATGGTAGAGG + Intergenic
1022383973 7:29884766-29884788 CACAGAGCTAGTAAGGGCAGGGG - Intronic
1024033694 7:45487986-45488008 CTCTGTGATAGTAAATGGAGTGG + Intergenic
1024614581 7:51100307-51100329 CTCTGTGATAGGAACTGTAGTGG + Intronic
1027412109 7:77931335-77931357 CACTGTGATAGTTAATGTATTGG - Intronic
1031756637 7:125652104-125652126 CACAGAGATAGTAATGGGAGGGG - Intergenic
1033242431 7:139691159-139691181 CACTGTGATAGTAAGGGTAGGGG - Intronic
1033589018 7:142795519-142795541 CACAGTGATGGTAATGGTGGGGG - Intergenic
1033841952 7:145386123-145386145 GGCTGTGATAGTAGTGGTAGTGG + Intergenic
1034960008 7:155359228-155359250 CGCTGTGATGGTCAGGGCAGGGG - Intronic
1037937060 8:22921989-22922011 CACTCTGATAAAAAGGGGAGAGG - Intronic
1038218402 8:25584449-25584471 CACTGTGCTTGGAAGGGAAGGGG + Intergenic
1039596123 8:38791329-38791351 GACTGTAATTGTAGGGGTAGAGG + Intronic
1041992098 8:64005722-64005744 CACTAAGATACTAAGGGTATGGG - Intergenic
1042537058 8:69869773-69869795 CACTGTGAGTGTAAGGATGGGGG - Intergenic
1046163361 8:110396166-110396188 AGCTGTGGTAGTAGGGGTAGAGG + Intergenic
1048969566 8:139637782-139637804 CACAATAATAGTAAGGGGAGTGG + Intronic
1049622082 8:143602972-143602994 CACTGTGGTAGGAAAGGAAGGGG + Exonic
1058638020 9:107055892-107055914 TACTGGGATAGTGAGGGGAGTGG + Intergenic
1062557139 9:137118542-137118564 CACTGTGTTAGTCAGGATTGTGG + Intergenic
1188225095 X:27587795-27587817 CAATGTGTTACTAAGGGCAGTGG + Intergenic
1189025608 X:37390666-37390688 CTCTGTGACAGTAAGAGTAGTGG - Intronic
1189719283 X:43898686-43898708 CACTATGATACTAGGGATAGAGG + Intergenic
1190054877 X:47175671-47175693 AGATGTGATAGGAAGGGTAGGGG - Intronic
1193311927 X:80020697-80020719 CACTGTGATGGCAGTGGTAGTGG - Intronic
1202080638 Y:21080632-21080654 CACAGTGACAGTAGGGATAGAGG + Intergenic