ID: 1033242432

View in Genome Browser
Species Human (GRCh38)
Location 7:139691160-139691182
Sequence ACACTGTGATAGTAAGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242432_1033242439 13 Left 1033242432 7:139691160-139691182 CCCTACCCTTACTATCACAGTGT 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242432_1033242438 -3 Left 1033242432 7:139691160-139691182 CCCTACCCTTACTATCACAGTGT 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242432 Original CRISPR ACACTGTGATAGTAAGGGTA GGG (reversed) Intronic
904666812 1:32128917-32128939 ACTCTGAGATAGTCTGGGTAAGG + Intronic
910459853 1:87437132-87437154 AAACTGTGGGAGTAGGGGTAGGG + Intergenic
914317072 1:146523402-146523424 AAACTGTGGGAGTAGGGGTAGGG + Intergenic
914497283 1:148209958-148209980 AAACTGTGGGAGTAGGGGTAGGG - Intergenic
916997791 1:170319833-170319855 ACACTGTAATAGTGAGGGAGTGG + Intergenic
917549795 1:176013745-176013767 ACACTGTGTTAGTAATAGTGAGG - Intronic
918893378 1:190306377-190306399 ACATTTTGATTGTAAGAGTAGGG + Intronic
919494089 1:198242337-198242359 ACACTTTGACAGCAAGAGTAAGG - Intronic
919569931 1:199235554-199235576 ACACAGTGAAAGTGAGGGGAGGG + Intergenic
922023000 1:221723021-221723043 ACAGGGTGATACTATGGGTAAGG - Intronic
923000425 1:230002521-230002543 AAACTTTGAGAGTAAGAGTAGGG + Intergenic
924017942 1:239748061-239748083 ACACTGTGAAAATAGGAGTAAGG + Intronic
1066488885 10:35875081-35875103 TTACTGTCATAGTAAGGATATGG + Intergenic
1068219058 10:54020186-54020208 TCACAGTGATTGTAAAGGTAAGG - Exonic
1069407050 10:68112827-68112849 TCACTGTGATAGTGAAGGGATGG + Intronic
1071092635 10:81936697-81936719 ACCCTGCTATAGTCAGGGTATGG + Intronic
1072856961 10:98957532-98957554 CCATTATGATAGGAAGGGTAAGG + Intronic
1073507740 10:104015496-104015518 AAAATGTGATACTAAGGGAAGGG + Intronic
1074317621 10:112373804-112373826 AGACTGTGATAGGAAGAGGAAGG - Intergenic
1075735075 10:124659641-124659663 ACTCTGTGAAAATAAGGGTGGGG - Intronic
1076084557 10:127614895-127614917 ACACAGTGACAGTCAGGTTAGGG + Intergenic
1076220321 10:128728565-128728587 ACCCTGTTAGAGCAAGGGTATGG + Intergenic
1080390766 11:31844121-31844143 ACACTGTGATAATAAATGTAGGG - Intronic
1087326511 11:96729730-96729752 ACACTAAGTTATTAAGGGTATGG + Intergenic
1087981471 11:104619064-104619086 ACACTGTGAAAGATAGGGTTGGG + Intergenic
1089581500 11:119484293-119484315 ACACTGTGGTGGAAAGGGGAAGG - Intergenic
1090966528 11:131602295-131602317 AAACTGTGTTAGTAAGGACAGGG + Intronic
1094207680 12:27857983-27858005 ACACTGTGGCAGTCAGGGAATGG + Intergenic
1098479865 12:70945057-70945079 CCCCTGTGATACTAAGAGTAAGG + Intergenic
1100682012 12:96935075-96935097 ACACTGTCAAAGTTATGGTATGG - Exonic
1109690834 13:65886634-65886656 ACATTGTGATACTTAGGATAAGG + Intergenic
1110474011 13:75892040-75892062 ACACTCAGATACTAATGGTATGG - Intergenic
1112665827 13:101572230-101572252 ACACTGTGATATGAAAGGGAAGG - Intronic
1115489829 14:33948603-33948625 ACACTGTGTAAGTTAGGGTAAGG - Intronic
1117905370 14:60579652-60579674 GCTCTGTGATAGTATGTGTATGG - Intergenic
1117950933 14:61082095-61082117 ACACTGTGTTAGGAAGTGTGGGG - Intronic
1118604710 14:67494391-67494413 TCACAGTGCTAGTAAGGGCAGGG + Intronic
1119964935 14:78904017-78904039 ATACTGTGATGGTGAGGATAAGG - Intronic
1121718825 14:96095407-96095429 ACCCTGGTATTGTAAGGGTATGG + Intergenic
1122287564 14:100660628-100660650 ACTCCGTGATAGTAAGGTCAAGG - Intergenic
1124073769 15:26421788-26421810 ACATTGTGTTAGTATGCGTATGG + Intergenic
1124710802 15:32008461-32008483 ACATTGTGAAGGTCAGGGTAGGG - Intergenic
1128911948 15:71523594-71523616 GGAGTGTGATAGCAAGGGTAGGG + Intronic
1130153077 15:81326039-81326061 ACCCTGTGTTGGTGAGGGTATGG + Intergenic
1131905947 15:97142693-97142715 ACCCTGTGATAGTTAGGGTCTGG + Intergenic
1133693572 16:8239133-8239155 ATACTGTGAAAGTCAGGCTAAGG + Intergenic
1138922263 16:61546089-61546111 ACACTGTGAGCCTAAGGGGAAGG + Intergenic
1141798418 16:86290219-86290241 ACTCTGTGTTACTAAGGGTATGG - Intergenic
1146991506 17:37277532-37277554 ACATTGTGTTAGTAAGTTTAGGG - Intronic
1149417510 17:56475147-56475169 AAACTGTGAAATTAATGGTAAGG - Intronic
1154028812 18:10732046-10732068 AAAATGTGATATTAAGGTTAAGG + Intronic
1155681718 18:28494754-28494776 ACACTGTGATAGGAAGGGAGAGG + Intergenic
1157093889 18:44668736-44668758 ACACTGTGAGAGTAAATCTAGGG - Intergenic
1158784829 18:60697918-60697940 ACACTGTGGGAGCAAGGGGATGG + Intergenic
925952948 2:8932847-8932869 TCACTGTGTTAGAAAGAGTATGG - Intronic
927190786 2:20515582-20515604 ACCCTGTGATGGCAAGGTTAAGG + Intergenic
927957148 2:27215539-27215561 AGACTCTGTGAGTAAGGGTATGG + Exonic
928721992 2:34131682-34131704 AGATTGTGAAAGTAAAGGTATGG + Intergenic
930515138 2:52397404-52397426 ATACTGTGATAGTAAGTTTTGGG + Intergenic
934690783 2:96357250-96357272 ACCCTGTGATATTATGGGGAGGG + Intronic
937075954 2:119106765-119106787 ACAGTGTTATAGAAAGAGTATGG - Intergenic
937223425 2:120354804-120354826 AGACTGTGATTGTAGGGGTGTGG + Intergenic
939116066 2:138062291-138062313 CCACTGTGATAGCAGGGGTGTGG + Intergenic
942796550 2:179827257-179827279 ACAGTGTGATAGGGAGGGTTGGG + Intronic
946450046 2:219771909-219771931 ACACTGTGATAACACTGGTAGGG - Intergenic
946699358 2:222396123-222396145 ACACTGAGGTACTAAGGGTTGGG + Intergenic
1173415773 20:42854481-42854503 ACACTGTGACAGAATGGGTGGGG + Intronic
1173728605 20:45313448-45313470 ACACTGTGAGGGTGAGGGTCAGG - Exonic
1178030356 21:28518926-28518948 ACACTTTCATGGTAAGGGTGTGG + Intergenic
1179656790 21:42850742-42850764 ACAGTGAGACAGTAAGGGTGGGG + Intronic
1180663936 22:17494630-17494652 CCAGTGAGATAGTAAGAGTAGGG + Intronic
1180697811 22:17764393-17764415 ACACTGAGATGGAAAGAGTAAGG + Intronic
1182771601 22:32800883-32800905 TCTCTGCGATAGTAAGGGAAGGG - Intronic
949772203 3:7591374-7591396 ACACAGTGATGGTAAGGATGTGG + Intronic
952595434 3:35011971-35011993 TCACTGTGATAGTAAGGCAATGG - Intergenic
953837792 3:46362206-46362228 ACACTGTGACAGAAGGAGTATGG + Intergenic
955759498 3:62263541-62263563 ATGCTTTGATACTAAGGGTAGGG + Intronic
957309733 3:78504624-78504646 ACACTGTGATAGTTTGGTTGTGG + Intergenic
958984223 3:100761631-100761653 ACACTGTGAAAGGAAAGGTAGGG + Intronic
961251226 3:125507430-125507452 GCACTGTGGTAGTAAGGAGAGGG + Intronic
967778050 3:193405018-193405040 GCACTGGCATAGTAAGGATAAGG + Intronic
970106202 4:12587860-12587882 ACACTGTGATAATAAGCTGAGGG - Intergenic
971803300 4:31320482-31320504 AGACTGTTATAGTAAGCATAAGG - Intergenic
979364099 4:119799909-119799931 AGACAGTGATACTAAGGGGAAGG + Intergenic
980054325 4:128065062-128065084 ACACTGTGATACTAGTTGTATGG + Intronic
986131210 5:4933180-4933202 ACAGTGTGGTACTAAGAGTATGG - Intergenic
986226352 5:5818139-5818161 TCACTGTGGTAGTAATGGTCAGG - Intergenic
987803636 5:22732511-22732533 ACTCTGGGATAGTAGGGGTTTGG - Intronic
988821309 5:34888834-34888856 ACAGTGTGATAGTTATGATATGG + Intronic
989390410 5:40894763-40894785 GCATTGTGATAGTGATGGTATGG - Intergenic
989630628 5:43478852-43478874 ACTCTGTGATAGTAGGAGTAGGG + Intronic
992073321 5:73168688-73168710 ACACAGTAAGAGTAAGTGTAAGG + Intergenic
994161571 5:96562478-96562500 ACATTGTGATAGTAAGGGTGTGG + Intronic
996035776 5:118757176-118757198 AAAATGTTATAGTAAGTGTATGG - Intergenic
997618388 5:135268896-135268918 GCCCAGTGCTAGTAAGGGTATGG - Intronic
999686057 5:154104245-154104267 ACAGTCTGATAGGGAGGGTATGG - Intronic
999723332 5:154415277-154415299 ATACTGTGAGGGTAAGGATAGGG + Intronic
999869516 5:155734566-155734588 GCAATGCAATAGTAAGGGTATGG - Intergenic
1000001081 5:157139960-157139982 ATACTGTGACAAAAAGGGTATGG - Intronic
1003483938 6:6558316-6558338 ACACTTAGAAAGTAAGGATACGG - Intergenic
1007229021 6:40335229-40335251 ACACTGTGAAAGAAATTGTAAGG + Intergenic
1011314563 6:86017157-86017179 CCAATGTCATATTAAGGGTAAGG + Intergenic
1018741813 6:166734849-166734871 ACACTGTCATGGTAAAGGTGAGG - Intronic
1027620679 7:80481358-80481380 AGGCTGTGATAGGAAGGGTGGGG + Intronic
1027638696 7:80707173-80707195 ACACTGTTATAATCAGGGAAGGG + Intergenic
1029302297 7:99590775-99590797 CCACTGTGATATTACGAGTAAGG + Intronic
1030428044 7:109405500-109405522 ACACAGTGACAGGAAGGTTAGGG + Intergenic
1031756638 7:125652105-125652127 ACACAGAGATAGTAATGGGAGGG - Intergenic
1032748682 7:134814180-134814202 GCTCTGTGATACAAAGGGTATGG + Intronic
1033242432 7:139691160-139691182 ACACTGTGATAGTAAGGGTAGGG - Intronic
1034454147 7:151156452-151156474 ACTCTGTGGTAGTAAGTGAAAGG - Intronic
1034611484 7:152374556-152374578 ACACTCTGCTAGTCAGGTTATGG + Intronic
1036353421 8:8026772-8026794 GCAGGGTGATAATAAGGGTAAGG - Intergenic
1036583694 8:10102742-10102764 ACACTGTGCTAGCAGGGGAAAGG + Intronic
1038993690 8:32898069-32898091 ATACTGAGATAGTGAGGGTTTGG - Intergenic
1041992099 8:64005723-64005745 GCACTAAGATACTAAGGGTATGG - Intergenic
1042240090 8:66654944-66654966 ACATTGTAAAAATAAGGGTATGG - Intronic
1044138106 8:88611979-88612001 ACACTGAGATATTTAAGGTAAGG + Intergenic
1044787379 8:95808906-95808928 ACACTGTGCTAAGAAGTGTAGGG + Intergenic
1044876726 8:96675681-96675703 ACATTGTGATGGAAAGGGAATGG - Intronic
1049622081 8:143602971-143602993 ACACTGTGGTAGGAAAGGAAGGG + Exonic
1051525355 9:18036911-18036933 ACCATGTAATAGTGAGGGTAGGG - Intergenic
1061581802 9:131542141-131542163 AGACTGTGAATGTGAGGGTAGGG - Intergenic
1187975474 X:24700900-24700922 ACACTGTGATGTTAATTGTATGG + Intronic
1188905710 X:35788781-35788803 ACGCTATGATAGTAAAGGTCAGG + Intergenic
1189096882 X:38149961-38149983 ACACTGTCACAGTAAGGCTCTGG - Intronic
1197574151 X:128188404-128188426 ACACTTTGATAGGGAGTGTATGG + Intergenic
1199132902 X:144214549-144214571 ATTCTGAGATACTAAGGGTAAGG + Intergenic
1199341990 X:146691399-146691421 ACATTGTGACAGTAAGTATAGGG - Intergenic
1199688019 X:150281530-150281552 ACACTGTCATACCAAGGGAAAGG - Intergenic