ID: 1033242433

View in Genome Browser
Species Human (GRCh38)
Location 7:139691161-139691183
Sequence CACACTGTGATAGTAAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242433_1033242439 12 Left 1033242433 7:139691161-139691183 CCTACCCTTACTATCACAGTGTG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242433_1033242438 -4 Left 1033242433 7:139691161-139691183 CCTACCCTTACTATCACAGTGTG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242433 Original CRISPR CACACTGTGATAGTAAGGGT AGG (reversed) Intronic
901414356 1:9106459-9106481 CCCACTGTGACCATAAGGGTTGG - Intronic
902925227 1:19691543-19691565 CACACTGTGGTGGCACGGGTGGG + Intronic
904956343 1:34287207-34287229 CTCATTATGATAGTGAGGGTAGG + Intergenic
915986455 1:160470244-160470266 CACACTGTGAAAGAAAGGGTTGG + Intergenic
918072224 1:181141467-181141489 CACAGTGTGAGAGTGTGGGTGGG + Intergenic
919613166 1:199772127-199772149 CACACTGTGCAGGTAGGGGTGGG + Intergenic
921414743 1:214872481-214872503 CACACTGAAATAGGAAGGGAGGG + Intergenic
921521791 1:216165348-216165370 CACAATGTGATAGCTATGGTGGG + Intronic
923000424 1:230002520-230002542 CAAACTTTGAGAGTAAGAGTAGG + Intergenic
1064423436 10:15209948-15209970 CACTCTGGGAAAGTAGGGGTGGG - Intergenic
1064848374 10:19682264-19682286 CACACAATGACAATAAGGGTGGG + Intronic
1065508400 10:26453430-26453452 TACACAGTGACAGTGAGGGTGGG + Intronic
1067395368 10:45911560-45911582 CACACCATGATAGGAAGTGTGGG + Intergenic
1067863688 10:49880681-49880703 CACACCATGATAGGAAGTGTGGG + Intronic
1068631945 10:59307413-59307435 CACTCTGGGGTAGTAAGGGCTGG - Intronic
1070198252 10:74178451-74178473 CATTCTGTGATAATAAGAGTGGG - Intronic
1072090702 10:92124463-92124485 CATTGTGTGATAGCAAGGGTGGG - Intronic
1073578968 10:104646544-104646566 CACTCTGTGATAGAAAGATTTGG + Intronic
1073742646 10:106426085-106426107 CACACTGGGTTAAAAAGGGTTGG + Intergenic
1074606396 10:114973001-114973023 TGCACTGTGAAACTAAGGGTAGG - Intronic
1075735076 10:124659642-124659664 CACTCTGTGAAAATAAGGGTGGG - Intronic
1077522783 11:3046199-3046221 CACACTGTGAGAGGAAGGAAGGG - Intronic
1080390767 11:31844122-31844144 GACACTGTGATAATAAATGTAGG - Intronic
1087150184 11:94852596-94852618 CAAAGTGTGAGAGTAAGAGTTGG + Intronic
1087981470 11:104619063-104619085 GACACTGTGAAAGATAGGGTTGG + Intergenic
1088208092 11:107418079-107418101 CACACTGTGAAAATAACTGTTGG - Intronic
1088538430 11:110886804-110886826 CACACTGAGAAAAAAAGGGTGGG + Intergenic
1090313174 11:125761153-125761175 CAGAGTGGGATGGTAAGGGTGGG + Intergenic
1091041380 11:132284624-132284646 CACACTGTGATACTGGCGGTTGG + Intronic
1091595399 12:1875290-1875312 CACACTGTTGTAGTTAGGTTTGG + Exonic
1096555761 12:52402725-52402747 GACACTGTGCTAGAAAGTGTGGG - Intronic
1107377703 13:39822227-39822249 CACACTGAGACATTAAGGGGTGG + Intergenic
1117730289 14:58715287-58715309 CACATTGTAAGAGTAAAGGTAGG - Intergenic
1117950934 14:61082096-61082118 GACACTGTGTTAGGAAGTGTGGG - Intronic
1127640811 15:60914250-60914272 CAGACTGCGAGAGAAAGGGTGGG + Intronic
1128059730 15:64727696-64727718 CTCAGTGTAATTGTAAGGGTAGG - Intergenic
1128161503 15:65425764-65425786 CACATTGTGATTGTGAGGGGTGG - Intergenic
1137359415 16:47799494-47799516 CACACTGTGATTTAAGGGGTGGG - Intergenic
1137950890 16:52782293-52782315 GACAGTGGGATAGGAAGGGTTGG - Intergenic
1138114737 16:54351265-54351287 CACACTGTGATCGTCATGTTGGG - Intergenic
1146991507 17:37277533-37277555 CACATTGTGTTAGTAAGTTTAGG - Intronic
1152608916 17:81306188-81306210 CACTCTGGGAGAGTCAGGGTCGG + Intergenic
1155159596 18:23184949-23184971 CCCACTGTGATAGTATGAGGTGG - Intronic
1155244498 18:23894436-23894458 CAGTCTGGGAAAGTAAGGGTGGG + Intronic
1159506838 18:69349127-69349149 CACACAGTGATTTTAGGGGTGGG + Intergenic
1160197724 18:76770554-76770576 CACACTGTCAGAGTCAGGCTGGG - Intergenic
1161434279 19:4253064-4253086 CACAGTAAGATACTAAGGGTGGG + Intronic
1162667153 19:12223507-12223529 CACACTGTGACACTGAGGTTTGG - Intergenic
1162737634 19:12755313-12755335 CACACAGGGATATTAAGTGTAGG - Intronic
1164245171 19:23422050-23422072 CACAGTGTGGGAGTGAGGGTAGG + Intergenic
1166995914 19:46719684-46719706 CACACAGTGATAATGCGGGTGGG + Exonic
1167642704 19:50690564-50690586 TACACTGGGATTGTGAGGGTGGG - Intronic
930257708 2:49110939-49110961 CACTGTGTGTTAATAAGGGTAGG - Intronic
930515137 2:52397403-52397425 AATACTGTGATAGTAAGTTTTGG + Intergenic
931824955 2:65990731-65990753 CACCCTGGGATAGGATGGGTAGG - Intergenic
932832364 2:75003360-75003382 CACACACTGCTAGTAAGGGGAGG + Intergenic
933942464 2:87255841-87255863 CACACTGGGTTAGGAAGGTTTGG + Intergenic
936337761 2:111605727-111605749 CACACTGGGTTAGGAAGGTTTGG - Intergenic
939365770 2:141228864-141228886 CACAATGTGATAGTGAAGGTGGG - Intronic
942796549 2:179827256-179827278 GACAGTGTGATAGGGAGGGTTGG + Intronic
946311089 2:218883102-218883124 CACTCTGGGATTGTCAGGGTGGG - Intronic
946699357 2:222396122-222396144 CACACTGAGGTACTAAGGGTTGG + Intergenic
947907288 2:233774605-233774627 CACACGCTGATAGTAAGTTTGGG - Intergenic
948370118 2:237483527-237483549 CACACTGTTAAAGTCTGGGTTGG - Intergenic
1173415772 20:42854480-42854502 CACACTGTGACAGAATGGGTGGG + Intronic
1179656789 21:42850741-42850763 AACAGTGAGACAGTAAGGGTGGG + Intronic
1180663934 22:17494629-17494651 CCCAGTGAGATAGTAAGAGTAGG + Intronic
1182771602 22:32800884-32800906 CTCTCTGCGATAGTAAGGGAAGG - Intronic
1184563165 22:45275091-45275113 CACACTGGGGTAGGAAGCGTGGG + Intergenic
952657013 3:35799050-35799072 CACACAGAGATAGGATGGGTGGG + Intergenic
953518271 3:43618145-43618167 GAAACTGTTATAGTAAGGATGGG - Intronic
954522590 3:51242680-51242702 CACAGTGTTAGAGCAAGGGTGGG + Intronic
958984222 3:100761630-100761652 TACACTGTGAAAGGAAAGGTAGG + Intronic
968360713 3:198144928-198144950 CACTGTGAGATTGTAAGGGTCGG - Intergenic
968676948 4:1887674-1887696 CACACTTTTATAGCAAGGTTTGG + Intronic
969231976 4:5838429-5838451 CAGACTGTGATGGGTAGGGTGGG + Intronic
969405608 4:6989528-6989550 CACACTGTGGGAGGAAGGGCAGG - Intronic
971552218 4:27971875-27971897 CACACAGTCATAGTAAAGGAGGG + Intergenic
978895187 4:113878440-113878462 CCTCCTGTGATGGTAAGGGTTGG - Intergenic
979286400 4:118930376-118930398 CACACAGTTTAAGTAAGGGTGGG - Intronic
983887243 4:172993960-172993982 CGGACTGTGATATGAAGGGTGGG - Intronic
986181020 5:5393024-5393046 CACACTGTGATGGTGGGGGCGGG + Intergenic
987707107 5:21471496-21471518 CACACTGTGATGGTGGGGGCGGG - Intergenic
989630627 5:43478851-43478873 TACTCTGTGATAGTAGGAGTAGG + Intronic
991149536 5:63350581-63350603 CACACTATGATATCAAGGCTAGG + Intergenic
991955779 5:71994802-71994824 CACACTGACCTATTAAGGGTGGG + Intergenic
992583663 5:78209201-78209223 CAGACCATGATAGGAAGGGTGGG + Intronic
992614120 5:78533456-78533478 CACGCTGTGAGAGTAGGGGATGG + Intronic
1009021120 6:57949012-57949034 CACACTGTGATGGTGGGGGCGGG + Intergenic
1013872357 6:114780638-114780660 CACACGGTCAAAGTAAGGGTAGG + Intergenic
1017730668 6:157312750-157312772 CACACTGTGACAGTAAGATGAGG - Intronic
1019259292 7:71704-71726 CACTGTGAGATTGTAAGGGTTGG + Intergenic
1023180132 7:37474207-37474229 CACAATGTGATAGAAAAGGGTGG - Intergenic
1027363031 7:77428891-77428913 CACAGGGTGATAGCAAGGTTGGG - Intergenic
1027620678 7:80481357-80481379 CAGGCTGTGATAGGAAGGGTGGG + Intronic
1028947503 7:96597140-96597162 CATACTGTCATAGTCAGGGCCGG + Intronic
1029109244 7:98203901-98203923 CACGCAGTGATAAAAAGGGTGGG + Intronic
1033173832 7:139107883-139107905 CACATAGTGACAGAAAGGGTGGG + Intronic
1033242433 7:139691161-139691183 CACACTGTGATAGTAAGGGTAGG - Intronic
1036221332 8:6923458-6923480 CACAGTCAGATAGGAAGGGTGGG - Intergenic
1038474844 8:27858270-27858292 CACAGTGTGATGGTAGGGATGGG + Intergenic
1044818896 8:96142825-96142847 CAAACTGTCAAAGAAAGGGTGGG - Exonic
1045381007 8:101625867-101625889 CACATCCTGATATTAAGGGTTGG + Intronic
1046355695 8:113082028-113082050 CACATAGTGATGGTCAGGGTGGG - Intronic
1047783770 8:128133832-128133854 CACACTGTGGTCGTAGGGGATGG + Intergenic
1048084989 8:131167660-131167682 CATTCTGAGATACTAAGGGTTGG - Intergenic
1049622080 8:143602970-143602992 CACACTGTGGTAGGAAAGGAAGG + Exonic
1054884004 9:70175928-70175950 CACAATGGGATTGTTAGGGTGGG - Intronic
1055321283 9:75085857-75085879 GACAATGTGATGGGAAGGGTGGG + Intronic
1058459799 9:105172359-105172381 CACACTCTGAAAGCAAGGGAGGG + Intergenic
1062745416 9:138208759-138208781 CACTGTGAGATTGTAAGGGTCGG - Intergenic
1185435975 X:95361-95383 CACACTGTGCCTGCAAGGGTGGG - Intergenic
1185444283 X:249661-249683 CACACTGTGCCTGCAAGGGTGGG + Intergenic
1185788083 X:2907419-2907441 CACGCCGTGATAGCAAGGGTAGG - Exonic
1190010641 X:46781541-46781563 CACACTGAGAGTGTGAGGGTGGG + Intergenic
1191031514 X:55978779-55978801 CACATTGTAATAGTAAGGACAGG + Intergenic
1192079230 X:68031590-68031612 CACAGGATGATAGTAGGGGTGGG + Intergenic
1194898216 X:99471321-99471343 CACACAGTAATAGTAGGGGATGG + Intergenic
1197313511 X:124935474-124935496 CACAGTGTGATAATAACAGTAGG - Intronic
1199170190 X:144726332-144726354 CAATCTGTGGTAGTAATGGTGGG - Intergenic
1201286919 Y:12387161-12387183 CACGCCATGATAGCAAGGGTAGG + Intergenic