ID: 1033242435

View in Genome Browser
Species Human (GRCh38)
Location 7:139691165-139691187
Sequence ATACCACACTGTGATAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242435_1033242439 8 Left 1033242435 7:139691165-139691187 CCCTTACTATCACAGTGTGGTAT 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242435_1033242438 -8 Left 1033242435 7:139691165-139691187 CCCTTACTATCACAGTGTGGTAT 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242435 Original CRISPR ATACCACACTGTGATAGTAA GGG (reversed) Intronic
905830788 1:41065581-41065603 ATACCACACTGTCTTAATTATGG - Intronic
906809891 1:48815422-48815444 ATACCACACTGTTCTACAAATGG - Intronic
913401194 1:118435412-118435434 ATGCCACACTGTGATAGCCTTGG + Intergenic
916529421 1:165641652-165641674 AAACCACACTGTGATATAAATGG + Intronic
917288535 1:173447004-173447026 ATACCACAGTGTATTAGTCAGGG - Intergenic
917582673 1:176395422-176395444 ATACTACACTGTCATAAAAAAGG - Intergenic
1063824203 10:9875813-9875835 ATACCACAGACTGATAGTGATGG - Intergenic
1068345334 10:55770543-55770565 ACCCCACACTGTGACAGTATTGG + Intergenic
1069601590 10:69711442-69711464 ATAGCACACTGTGGTGGTCAGGG + Intergenic
1073855980 10:107673675-107673697 AGACCACTGTGTGATAGTTATGG - Intergenic
1078023842 11:7675831-7675853 ATACTACACTGTTTTAGTTACGG + Intronic
1080574475 11:33585650-33585672 ATGCCATACTGAGATTGTAAGGG + Intronic
1080727315 11:34911318-34911340 ATAGGACACTGTGATAGTTAAGG + Intronic
1082215538 11:49562793-49562815 ATACTATAAAGTGATAGTAAAGG - Intergenic
1086634038 11:89061688-89061710 ATACTATAAAGTGATAGTAAAGG + Intronic
1088539277 11:110896221-110896243 ATATCACCCTGTTACAGTAAAGG + Intergenic
1095696985 12:45154744-45154766 ACACCACACTGTGATATTGTTGG + Intergenic
1097743695 12:63275106-63275128 ATGCCACACTGTGGTAATCACGG + Intergenic
1099798405 12:87426607-87426629 ATGCCACATTGTTTTAGTAATGG - Intergenic
1103853491 12:123948288-123948310 ATACCACACTATGATAGAGATGG - Intronic
1103967374 12:124648303-124648325 ATAAAACACTATGATTGTAAAGG - Intergenic
1108457820 13:50634253-50634275 ATATCACAATGTAATAATAATGG - Intronic
1112665830 13:101572235-101572257 AAACCACACTGTGATATGAAAGG - Intronic
1115862911 14:37709419-37709441 ATACCAAACTGTCATACTGATGG - Intronic
1117417124 14:55507527-55507549 ATACCACATTGTATTAGTCAGGG + Intergenic
1118134907 14:63012801-63012823 CTACCACACTGTAATATTTATGG - Intronic
1120300553 14:82701164-82701186 ATACCACTCTGGGCTAGAAATGG - Intergenic
1121246870 14:92467272-92467294 ATACCACATTATTAGAGTAAAGG + Intronic
1125411670 15:39412665-39412687 ACTCCTCACTGTGATAGTTAAGG + Intergenic
1126824762 15:52538038-52538060 ATACCACTCTATAATAGTCAGGG - Intergenic
1131784484 15:95897101-95897123 AAAACACATTGTGATAATAAAGG - Intergenic
1139195495 16:64913988-64914010 GTACCACACTGTGTTAGTTTTGG + Intergenic
1139598905 16:67974670-67974692 ATACCACACTGTCTTAATTATGG - Intergenic
1154273311 18:12938433-12938455 AGACTATACTGTGATAGGAACGG + Intergenic
1154404765 18:14079526-14079548 ATACCACACTGTCTTCATAACGG - Intronic
1155681717 18:28494749-28494771 AAATCACACTGTGATAGGAAGGG + Intergenic
1155926119 18:31657319-31657341 GTACCACACAGTAATAGTTAAGG + Intronic
1158448824 18:57545367-57545389 ACAACATACTGTGATAGTACCGG - Intergenic
1160284540 18:77528691-77528713 GCACCACACTGTATTAGTAAAGG - Intergenic
1166519084 19:43467643-43467665 AGGCCACACTGCGACAGTAAAGG + Intergenic
925761076 2:7184985-7185007 ATACCACACGGTGATTGAGATGG + Intergenic
925796968 2:7556081-7556103 ATAAAACACTGTAAGAGTAAGGG + Intergenic
926324412 2:11771913-11771935 ATATTACAATGTAATAGTAATGG - Intronic
927321244 2:21748241-21748263 AAACCACACTTTGAGAGTGAAGG - Intergenic
927462560 2:23311774-23311796 AGACCAAACTGTTATAGAAATGG + Intergenic
931468018 2:62508850-62508872 GTACCACACTGTGCTAGTGTTGG - Intronic
933731893 2:85462552-85462574 ATAACACCTTGTGATAGTGAGGG + Intergenic
937777850 2:125801865-125801887 ATACAACTCTGTGATAATGAAGG + Intergenic
937874102 2:126807836-126807858 ATACCACACTGCAATAAGAATGG + Intergenic
941051998 2:160745603-160745625 ATACCACACTGTCTTAATTATGG - Intergenic
941192065 2:162397207-162397229 ATACCCCACTTTGCTAGCAAAGG + Intronic
946582879 2:221149792-221149814 ATTCAACTCTGTTATAGTAATGG - Intergenic
946597038 2:221317350-221317372 ATACCATGTTGTGGTAGTAATGG + Intergenic
1170351603 20:15447672-15447694 ATAATACACTGGGATAGAAAAGG - Intronic
1170445246 20:16420011-16420033 ATTCCACACTGTGATTCTATAGG - Intronic
1170615936 20:17950944-17950966 ATACCAGACAGTAATTGTAAGGG + Intronic
1170834958 20:19876363-19876385 ATACCCCAATGAGATAATAAAGG + Intergenic
1174239753 20:49124109-49124131 ATACCCCACTGTGATCGCCAGGG + Intronic
1175467749 20:59203731-59203753 ATACCACACTGTAATGAAAATGG + Intronic
1177309338 21:19368734-19368756 AAACAAATCTGTGATAGTAAAGG - Intergenic
1177892124 21:26818720-26818742 ATATCACACCGTGATAGCCAAGG - Intergenic
1177953917 21:27573022-27573044 ATTCCACAATGAGAAAGTAAAGG + Intergenic
952875508 3:37941331-37941353 ATACCCCACAGGGAGAGTAAAGG - Intronic
956268386 3:67423817-67423839 ATACCTCACTGTTTTAATAATGG - Intronic
957189858 3:76993675-76993697 ATACCATACTTTGATGGGAAGGG + Intronic
957340756 3:78893041-78893063 TTACCACAGTGTGATGGCAATGG - Intronic
957425287 3:80030451-80030473 AAACCTCATTGTGATAATAATGG + Intergenic
960258494 3:115536851-115536873 AAACCAAACCGTGATATTAAAGG - Intergenic
961625360 3:128258682-128258704 ATAGCAAACTGTCATAGTATTGG + Intronic
965376720 3:167933665-167933687 ATACCACAGTGTGATACTTTAGG - Intergenic
967705592 3:192646319-192646341 ATACCATACTGTGCTGGAAATGG - Intronic
968177289 3:196562117-196562139 AGACCACACTTTGAGAGTACTGG - Intronic
968535447 4:1124939-1124961 ATAACATAATGTGGTAGTAAGGG - Intergenic
969856051 4:10000750-10000772 ATTCCACACTGGTTTAGTAAGGG - Intronic
975853053 4:78593169-78593191 ATCCCCAACTGTGATATTAAAGG - Intronic
977909564 4:102517072-102517094 ATACCAAGCTGTGATAGTGTAGG - Intronic
979840451 4:125433169-125433191 ATACCATTCTGTGATAATGAGGG + Intronic
980203566 4:129688022-129688044 ATACCAAACTCTGAAATTAAAGG - Intergenic
982617855 4:157664056-157664078 ATCCCACACTGAGGTAATAATGG - Intergenic
983323651 4:166226739-166226761 ATACCACACTGGGATGGCACAGG + Intergenic
984029417 4:174584392-174584414 ATCACATAATGTGATAGTAATGG + Intergenic
984489669 4:180416850-180416872 TTACCACACCGTGTTAGAAATGG + Intergenic
984579637 4:181496768-181496790 GTAACACACTGTGAAAGTAATGG - Intergenic
986957683 5:13174670-13174692 ATACCACACTTTAATAAAAATGG - Intergenic
989406574 5:41067877-41067899 ATATCACTCCCTGATAGTAAGGG - Intronic
994161570 5:96562473-96562495 ATAATACATTGTGATAGTAAGGG + Intronic
997159913 5:131596813-131596835 ATACAACACTGTGCTAGGCAAGG + Intronic
998039109 5:138940350-138940372 ATGCCACACTGTGGTATTACAGG + Intergenic
998216533 5:140241863-140241885 ATACCCAACTGGGATAGAAAAGG - Intronic
1000713593 5:164611279-164611301 ATCCCACACTGTGAAAAAAATGG + Intergenic
1000765228 5:165280978-165281000 TTATCACAATGTGAAAGTAAAGG + Intergenic
1002403252 5:179005935-179005957 ATACCACACTGTTTTGGTCAGGG - Intergenic
1002833094 6:842026-842048 ATATCACACTGAGACAGGAAAGG - Intergenic
1005287354 6:24342271-24342293 AAGCAACACTGTGAAAGTAAAGG - Intronic
1006609510 6:35285693-35285715 TTAGCACACTGTCATAGTGAGGG + Intronic
1008359881 6:50603571-50603593 ATACCACCATATGATACTAATGG + Intergenic
1012891674 6:104904088-104904110 ATACCACACTGTCTTGATAACGG + Intergenic
1013724048 6:113070626-113070648 ATACCACAATTTGATTTTAAAGG + Intergenic
1013861007 6:114635364-114635386 ATATCATATTGTGATATTAATGG + Intergenic
1017304663 6:152902891-152902913 ACACCACACTTTGATTGGAAAGG + Intergenic
1021309760 7:19079538-19079560 ATACCACTCTGTTACAGTACAGG - Intronic
1021743123 7:23708346-23708368 ATACCACACTGTCTTAATTACGG - Intergenic
1021800529 7:24301666-24301688 TTACTACACTGAGGTAGTAAGGG - Intergenic
1024650843 7:51402202-51402224 ATATTACAATGTAATAGTAATGG - Intergenic
1024808641 7:53181128-53181150 ATACCATACTGTGATGCTTATGG - Intergenic
1027569095 7:79840588-79840610 ATACCACATTGTAAAAGTAAGGG - Intergenic
1027569191 7:79841822-79841844 ATATCACATTGTAAAAGTAAGGG - Intergenic
1027864700 7:83630584-83630606 ATATCACACTGTGATAAACAAGG - Intronic
1029302513 7:99594131-99594153 TTTACACACTGTGATATTAACGG - Intronic
1033242435 7:139691165-139691187 ATACCACACTGTGATAGTAAGGG - Intronic
1033710935 7:143942971-143942993 ATGCCACAGTGTGATGGTATTGG - Intergenic
1037059094 8:14484237-14484259 ATAGCAAACTATGATAGAAATGG - Intronic
1039561563 8:38516405-38516427 ATACCTGAATGTGATAGAAATGG + Exonic
1041469694 8:58194964-58194986 TTAACACAATGTGATAGTAGTGG + Intronic
1041728606 8:61042581-61042603 ATCCCCCAATGTGATAGTATTGG - Intergenic
1043416911 8:80060685-80060707 ATACCACATTAATATAGTAAAGG + Intronic
1043632917 8:82359164-82359186 ATACCAAACAGTAACAGTAATGG - Intergenic
1044088352 8:87970241-87970263 ATATGTCACTGTGATAGTACAGG - Intergenic
1044138104 8:88611974-88611996 CTACCACACTGAGATATTTAAGG + Intergenic
1045661254 8:104440446-104440468 GGACCACACTGTGAGAGTCAAGG + Intronic
1046580009 8:116080624-116080646 ATTGCACAGTGTGATAATAAAGG + Intergenic
1047181033 8:122588353-122588375 ATATCACACTGTGAAAGCAGGGG - Intergenic
1047646958 8:126879554-126879576 ATACCACACTGTGCTTGCAGGGG + Intergenic
1047895306 8:129360011-129360033 AAACAACACTGTCATAATAATGG + Intergenic
1049622079 8:143602966-143602988 ACATCACACTGTGGTAGGAAAGG + Exonic
1051259295 9:15246575-15246597 ATACAACACTGTGTTAGTTTGGG + Intronic
1052177455 9:25481312-25481334 AAACCACACTGCTATAGTGAAGG + Intergenic
1054958565 9:70941599-70941621 ATACCACACTGTATTAGTCAGGG - Intronic
1055797634 9:79992476-79992498 AATCCACACAGTGATAGTACTGG - Intergenic
1058121215 9:101141226-101141248 ATTCCACACTGTGAAAGTATTGG + Intronic
1058844115 9:108938662-108938684 ATTCCCCAGTGTGTTAGTAAGGG - Intronic
1185788085 X:2907423-2907445 GTACCACGCCGTGATAGCAAGGG - Exonic
1188312863 X:28639276-28639298 ATAACACACTCTGATAATAAGGG - Intronic
1192372986 X:70530776-70530798 ATAAAACACTGTGATAATGAGGG + Intronic
1193004998 X:76606546-76606568 ATTCCCAACTGTGATAGTAATGG + Intergenic
1197020324 X:121679641-121679663 ATTCCACAGGGTTATAGTAAGGG + Intergenic
1199194694 X:145014280-145014302 ATAACACACTGTGATAGACTGGG + Intergenic