ID: 1033242436

View in Genome Browser
Species Human (GRCh38)
Location 7:139691166-139691188
Sequence AATACCACACTGTGATAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242436_1033242439 7 Left 1033242436 7:139691166-139691188 CCTTACTATCACAGTGTGGTATT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242436_1033242438 -9 Left 1033242436 7:139691166-139691188 CCTTACTATCACAGTGTGGTATT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1033242438 7:139691180-139691202 TGTGGTATTGGCTCTATATGTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242436 Original CRISPR AATACCACACTGTGATAGTA AGG (reversed) Intronic
909603515 1:77485674-77485696 AACACCAAACTGAGATAGTTAGG + Intronic
920440573 1:205978129-205978151 AAAACCACACTGTGATACAGGGG + Exonic
922679200 1:227577345-227577367 ACTCCCACACAGTAATAGTAGGG - Intronic
1064843050 10:19617650-19617672 AATCCTACACTGTAGTAGTAAGG + Intronic
1066706356 10:38183231-38183253 AATACCACTCAGTCATAATAAGG - Intergenic
1068175534 10:53452473-53452495 ACTTCAACACTGTGAGAGTATGG + Intergenic
1071131052 10:82394095-82394117 AATAGCACAGTGTGATGTTATGG - Intronic
1072483999 10:95837106-95837128 ACTACCTCACTGTGTAAGTAAGG + Intronic
1082282894 11:50289427-50289449 TATACTTCACTGTGGTAGTAAGG + Intergenic
1085452890 11:76647367-76647389 AATACTACTCAGTGATAGGAAGG + Intergenic
1087966181 11:104418839-104418861 ATTACCACACTGTGCTACTGTGG - Intergenic
1093322525 12:17731124-17731146 AATACCACAGTGAGATTGTCTGG - Intergenic
1099446381 12:82756826-82756848 AATATCACACAGCTATAGTAGGG + Intronic
1101903234 12:108807028-108807050 AACACCACACTGTGGGAGCAGGG + Intronic
1111164397 13:84439292-84439314 AATCCCACAGTGTTATAATATGG - Intergenic
1111501468 13:89126994-89127016 AAAACCGCTCTGTGCTAGTAGGG - Intergenic
1114056842 14:18977245-18977267 AATACCCCACTGAGATAAGAGGG + Intronic
1114105704 14:19424497-19424519 AATACCCCACTGAGATAAGAGGG - Intronic
1116472080 14:45297169-45297191 CAAACCACACTTTGATAGCAAGG + Intergenic
1116721412 14:48500802-48500824 AATACTCCAGTGTGATATTATGG + Intergenic
1120292438 14:82592167-82592189 AATTCCACACTGGGAAAGCAAGG - Intergenic
1125151804 15:36541006-36541028 AATAACACACAGTAATATTAGGG - Intergenic
1131966035 15:97843836-97843858 AATATCCCACTGTGATATTCTGG - Intergenic
1134166620 16:11935189-11935211 AAAAGCATACTGTGATAATATGG - Intronic
1134494087 16:14718515-14718537 AAAAGCATACTGTGATAATATGG + Intronic
1134499467 16:14757639-14757661 AAAAGCATACTGTGATAATATGG + Intronic
1134526017 16:14944267-14944289 AAAAGCATACTGTGATAATATGG + Intronic
1134546390 16:15112096-15112118 AAAAGCATACTGTGATAATATGG - Intronic
1134581105 16:15371380-15371402 AAAAGCATACTGTGATAATATGG - Intronic
1134713597 16:16342754-16342776 AAAAGCATACTGTGATAATATGG + Intergenic
1134721467 16:16386112-16386134 AAAAGCATACTGTGATAATATGG + Intronic
1134852344 16:17490434-17490456 AATACTACTCTGTGATAAAAAGG + Intergenic
1134945959 16:18325772-18325794 AAAAGCATACTGTGATAATATGG - Intronic
1134953222 16:18365916-18365938 AAAAGCATACTGTGATAATATGG - Intergenic
1135312010 16:21412603-21412625 AAAAGCATACTGTGATAATATGG - Intronic
1135364959 16:21845059-21845081 AAAAGCATACTGTGATAATATGG - Intronic
1135446881 16:22526280-22526302 AAAAGCATACTGTGATAATATGG + Intronic
1136151178 16:28350528-28350550 AAAAGCATACTGTGATAATATGG - Intronic
1136167412 16:28464367-28464389 AAAAGCATACTGTGATAATATGG - Intronic
1136195565 16:28650650-28650672 AAAAGCATACTGTGATAATATGG + Intronic
1136211903 16:28764766-28764788 AAAAGCATACTGTGATAATATGG + Intronic
1136256623 16:29044711-29044733 AAAAGCATACTGTGATAATATGG + Intronic
1136308713 16:29391596-29391618 AAAAGCATACTGTGATAATATGG - Intronic
1136322130 16:29493126-29493148 AAAAGCATACTGTGATAATATGG - Intronic
1136436809 16:30233098-30233120 AAAAGCATACTGTGATAATATGG - Intronic
1139856417 16:69984026-69984048 AAAAGCATACTGTGATAATATGG - Intergenic
1140366314 16:74384036-74384058 AAAAGCATACTGTGATAATATGG + Intronic
1140848275 16:78910453-78910475 AACACCACACTGTTCTAATACGG - Intronic
1144017765 17:11212854-11212876 AATAGAACACTGTGTTAGAAGGG + Intergenic
1153108827 18:1560065-1560087 ACTACCACTCTGTGTAAGTAGGG + Intergenic
1153329866 18:3862829-3862851 AATGCCACACTGTGAGGGCATGG + Intronic
1154117891 18:11627290-11627312 AAAAGCACACTGTGATAATATGG - Intergenic
1155681716 18:28494748-28494770 AAAATCACACTGTGATAGGAAGG + Intergenic
1157719679 18:49914152-49914174 AAAACCACACTGTGACACTGGGG + Intronic
1157774472 18:50381398-50381420 ATTACCATGCTGTGATAATATGG + Intronic
1161718466 19:5890553-5890575 AATACCTCACTGAGAAAGGAAGG - Intronic
1167771984 19:51526445-51526467 TATACCCCACTGTGAAACTAAGG + Intronic
925796967 2:7556080-7556102 AATAAAACACTGTAAGAGTAAGG + Intergenic
930960791 2:57259170-57259192 AATGCCAGACTGTGATAGCCAGG + Intergenic
931126121 2:59278789-59278811 AATACCACTCAGTGATAAAAAGG - Intergenic
933113258 2:78431737-78431759 AATACCACACTCAGATCCTAGGG - Intergenic
933731892 2:85462551-85462573 AATAACACCTTGTGATAGTGAGG + Intergenic
934994395 2:98943872-98943894 AATACTACACAGTGATAAAAAGG - Intergenic
938285455 2:130110874-130110896 AATACCCCACTGAGATAAGAGGG - Intronic
938336098 2:130499415-130499437 AATACCCCACTGAGATAAGAGGG - Intronic
938353724 2:130621250-130621272 AATACCCCACTGAGATAAGAGGG + Intronic
938430149 2:131228028-131228050 AATACCCCACTGAGATAAGAGGG + Intronic
942674913 2:178416536-178416558 AATCCCATGCTGTGATAGAATGG - Intergenic
946293062 2:218760394-218760416 AATACCACTCTGTAATAAAAAGG + Intergenic
946988940 2:225305785-225305807 AATAACATACTGTTTTAGTAAGG - Intergenic
947758999 2:232589609-232589631 AATAAAACACTGTGATTGTTGGG + Intergenic
1173884001 20:46440762-46440784 AATACCACTCAGTGATAAAAAGG + Intergenic
1174239752 20:49124108-49124130 AATACCCCACTGTGATCGCCAGG + Intronic
1176009764 20:62886676-62886698 AAGGCCTCACTGTGATAGTTTGG - Intronic
1179242451 21:39604260-39604282 AAAACAACACTGTGATGTTAAGG - Intronic
1180475329 22:15699858-15699880 AATACCCCACTGAGATAAGAGGG + Intronic
951014362 3:17713818-17713840 AAAACCACAATGGGAAAGTAGGG + Intronic
953486283 3:43299769-43299791 AACAAAACACTGTGATAATAAGG + Exonic
953676209 3:45004600-45004622 AAAACTACACTGTGATACCAAGG - Intronic
958666244 3:97141217-97141239 AATCCCCCACTATGATTGTATGG - Intronic
961407459 3:126691763-126691785 AATACAACACTGATATAGTTTGG - Intergenic
961612085 3:128147897-128147919 AATACTACACAGTGATAAAAAGG + Intronic
963908319 3:150792566-150792588 AATTCCACACTGTGACTCTAAGG + Intergenic
965048387 3:163610853-163610875 AAAACCACAATGAGATACTATGG - Intergenic
968098509 3:195949066-195949088 AATACAACAGTGTTATATTAAGG + Intergenic
968826272 4:2899965-2899987 GAGCCCACACTGTGATAGGAGGG + Intronic
968851438 4:3082510-3082532 GAGACCTCACTGTGATAGCAAGG - Intronic
971852436 4:31999846-31999868 AATACAACATTGTGATGTTAGGG - Intergenic
976046925 4:80960673-80960695 AAGACTACACTGTGAGAATAGGG - Intronic
978463154 4:108980010-108980032 AATACCACTCTGTCAGAGAAAGG + Intronic
978860036 4:113438103-113438125 AATATCTCATTGGGATAGTATGG + Intergenic
979840450 4:125433168-125433190 AATACCATTCTGTGATAATGAGG + Intronic
982381052 4:154747904-154747926 AATACACCACTTTGACAGTATGG - Intronic
987866529 5:23547118-23547140 ACAACCACACAGTAATAGTAGGG - Intergenic
990344483 5:54858032-54858054 AATACAACCCTGTGAATGTAAGG + Intergenic
992562094 5:77963014-77963036 AATACCACACAAGGAGAGTAGGG - Intergenic
994161569 5:96562472-96562494 GATAATACATTGTGATAGTAAGG + Intronic
997717322 5:136051935-136051957 AAAACCACACTGTCATAGGCAGG - Intronic
1001176584 5:169474584-169474606 AAGACCTCTCTGTGATGGTAGGG + Intergenic
1003247502 6:4396570-4396592 AATACTACACTGTGATGAAAAGG + Intergenic
1007403710 6:41620127-41620149 AATATCACACTGTAATTTTATGG + Intergenic
1008164858 6:48124166-48124188 AATGAAAAACTGTGATAGTATGG - Intergenic
1013651325 6:112198062-112198084 AATACCACACTCTCATACTAGGG - Intronic
1014163697 6:118199888-118199910 AATACAACAATGTGGTTGTAAGG - Intronic
1014192265 6:118510574-118510596 AATAACACACTCTGTTAGCATGG + Intronic
1014339285 6:120182687-120182709 AAAACCACAATGAGATAGAATGG - Intergenic
1014832682 6:126121586-126121608 AATTCCACATTTTGAAAGTAAGG - Intergenic
1014881008 6:126724545-126724567 AAAACAAGACTGTAATAGTATGG - Intergenic
1017207080 6:151814576-151814598 AATACCACTCTGAGTTATTACGG - Intronic
1018517782 6:164605933-164605955 AAAAGTATACTGTGATAGTAGGG + Intergenic
1019717197 7:2544771-2544793 AAGACTGCACTGTGACAGTACGG - Intronic
1020778615 7:12489997-12490019 AATATAAGATTGTGATAGTATGG - Intergenic
1027569096 7:79840589-79840611 CATACCACATTGTAAAAGTAAGG - Intergenic
1027569192 7:79841823-79841845 AATATCACATTGTAAAAGTAAGG - Intergenic
1029891434 7:103934063-103934085 AATTCCACAGTGTCATGGTATGG - Intronic
1033216747 7:139499003-139499025 AATGGCACACTGTGATATTCAGG + Intergenic
1033242436 7:139691166-139691188 AATACCACACTGTGATAGTAAGG - Intronic
1035311585 7:157973052-157973074 AATTCCACACTGTGATAGCAGGG + Intronic
1038474841 8:27858265-27858287 AGGACCACAGTGTGATGGTAGGG + Intergenic
1039918580 8:41877163-41877185 ACTTCCACACTGTCATAGAAGGG + Intronic
1047181034 8:122588354-122588376 CATATCACACTGTGAAAGCAGGG - Intergenic
1047646957 8:126879553-126879575 CATACCACACTGTGCTTGCAGGG + Intergenic
1050979135 9:11986865-11986887 AATACCACACAGCCATAGAAAGG - Intergenic
1051259294 9:15246574-15246596 AATACAACACTGTGTTAGTTTGG + Intronic
1052096122 9:24386489-24386511 AATAGCCCACTGGGATACTATGG + Intergenic
1054958566 9:70941600-70941622 GATACCACACTGTATTAGTCAGG - Intronic
1058844116 9:108938663-108938685 AATTCCCCAGTGTGTTAGTAAGG - Intronic
1187907338 X:24079628-24079650 CATACAACTCTGTGATAGTAAGG + Intergenic
1188312864 X:28639277-28639299 AATAACACACTCTGATAATAAGG - Intronic
1188952639 X:36395143-36395165 AATACTACTCTGTGATATAAAGG - Intergenic
1189552647 X:42109551-42109573 AGTGCCACACTATGAAAGTAGGG - Intergenic
1193736239 X:85159968-85159990 AAGAACACACTGTGATGGTGGGG - Intergenic
1199194693 X:145014279-145014301 GATAACACACTGTGATAGACTGG + Intergenic
1202194934 Y:22290714-22290736 AATGCAACACTGTGTCAGTAAGG - Intergenic