ID: 1033242439

View in Genome Browser
Species Human (GRCh38)
Location 7:139691196-139691218
Sequence TATGTGGCTAGCTGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033242436_1033242439 7 Left 1033242436 7:139691166-139691188 CCTTACTATCACAGTGTGGTATT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242435_1033242439 8 Left 1033242435 7:139691165-139691187 CCCTTACTATCACAGTGTGGTAT 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242431_1033242439 14 Left 1033242431 7:139691159-139691181 CCCCTACCCTTACTATCACAGTG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242433_1033242439 12 Left 1033242433 7:139691161-139691183 CCTACCCTTACTATCACAGTGTG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242430_1033242439 15 Left 1033242430 7:139691158-139691180 CCCCCTACCCTTACTATCACAGT 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242432_1033242439 13 Left 1033242432 7:139691160-139691182 CCCTACCCTTACTATCACAGTGT 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data
1033242429_1033242439 16 Left 1033242429 7:139691157-139691179 CCCCCCTACCCTTACTATCACAG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033242439 Original CRISPR TATGTGGCTAGCTGCAGAGC TGG Intronic
No off target data available for this crispr