ID: 1033243325

View in Genome Browser
Species Human (GRCh38)
Location 7:139699168-139699190
Sequence CAGGCTGGTGGGAGAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 978
Summary {0: 1, 1: 1, 2: 10, 3: 110, 4: 856}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033243325_1033243336 8 Left 1033243325 7:139699168-139699190 CCGCCATCTCTCCCACCAGCCTG 0: 1
1: 1
2: 10
3: 110
4: 856
Right 1033243336 7:139699199-139699221 TCTCATTTCCCCAGGGCCGCAGG No data
1033243325_1033243335 1 Left 1033243325 7:139699168-139699190 CCGCCATCTCTCCCACCAGCCTG 0: 1
1: 1
2: 10
3: 110
4: 856
Right 1033243335 7:139699192-139699214 GGCAGTATCTCATTTCCCCAGGG No data
1033243325_1033243337 9 Left 1033243325 7:139699168-139699190 CCGCCATCTCTCCCACCAGCCTG 0: 1
1: 1
2: 10
3: 110
4: 856
Right 1033243337 7:139699200-139699222 CTCATTTCCCCAGGGCCGCAGGG No data
1033243325_1033243334 0 Left 1033243325 7:139699168-139699190 CCGCCATCTCTCCCACCAGCCTG 0: 1
1: 1
2: 10
3: 110
4: 856
Right 1033243334 7:139699191-139699213 GGGCAGTATCTCATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033243325 Original CRISPR CAGGCTGGTGGGAGAGATGG CGG (reversed) Intronic
900379963 1:2378845-2378867 CAGGCTGGTGGGGGTGCTCGTGG + Intronic
900522099 1:3110796-3110818 CAGGAGCGTGGGAGGGATGGAGG + Intronic
900593839 1:3471576-3471598 CTGGCTGGGGGCAGAGCTGGGGG - Intronic
900810518 1:4798319-4798341 CAGGCTGGAGGGACATGTGGAGG + Intergenic
900975137 1:6012002-6012024 CATGGTGGTGGTAGAGGTGGAGG + Intronic
901192306 1:7419936-7419958 CAGGATGGAGGGCGGGATGGTGG - Intronic
901656242 1:10771254-10771276 CAGGCAGGTTGGGGAGGTGGGGG + Intronic
901659224 1:10788334-10788356 CAGGCAGGTGGGAGTAGTGGTGG + Intronic
901735048 1:11306887-11306909 CAGGTGGGTGGAAGAGTTGGGGG - Intergenic
901769222 1:11521997-11522019 CATGCTGATGGCAGCGATGGTGG + Intronic
901821556 1:11833616-11833638 CATCCTGGTGGAAGAGCTGGAGG - Exonic
901824939 1:11855070-11855092 TAGGCTTGTGGGTGGGATGGAGG - Intergenic
902092341 1:13913487-13913509 CTGGATGGTGGGAGAGTTTGGGG + Intergenic
902680369 1:18039707-18039729 GGGGCTGGTAGGAAAGATGGAGG + Intergenic
902708566 1:18223162-18223184 CAGGCTCACGTGAGAGATGGTGG - Intronic
902728750 1:18354623-18354645 TAGGCTTGGGGGAGGGATGGGGG - Intronic
902747619 1:18483801-18483823 CACACAGGTGGGAAAGATGGAGG + Exonic
902895803 1:19479275-19479297 CAGTCTGCTGAGGGAGATGGTGG - Intronic
903008595 1:20314669-20314691 CAGGGTGGGGGGAGACAGGGAGG + Intronic
903128643 1:21264005-21264027 CAGGATGGCGGCAGAGAAGGGGG + Intronic
903548434 1:24141495-24141517 GAGGCTGGTGGCTGAGGTGGGGG + Intronic
904036822 1:27563549-27563571 CAGGCTGGTGACAGTGATGGGGG - Intronic
904493235 1:30872961-30872983 CAGACTGGTGGCAGGGATGAGGG + Intronic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904767413 1:32861137-32861159 CAGGCCTGTGGGAGAAATGCTGG - Intergenic
904789120 1:33005221-33005243 CAGGCTGGCAGGAGACATTGTGG - Intergenic
905060631 1:35136469-35136491 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
905310826 1:37047624-37047646 CCGGCATGTGTGAGAGATGGGGG - Intergenic
905791642 1:40792660-40792682 CAGTCTGGTGGGAGAGACGGGGG + Intronic
905863761 1:41366136-41366158 CAGGCTGGGGGGAGAGGAAGCGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906080811 1:43087058-43087080 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
906682956 1:47743174-47743196 CATGTTGGTGGAAGTGATGGTGG + Intergenic
907118609 1:51990274-51990296 GGGGCTGGGAGGAGAGATGGGGG - Intronic
907292521 1:53425838-53425860 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
907375429 1:54034232-54034254 AGGGCTGGAGGGTGAGATGGGGG + Intronic
907521146 1:55024168-55024190 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
909683444 1:78319031-78319053 CAAGGAGTTGGGAGAGATGGAGG + Intronic
909729274 1:78873458-78873480 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
911090598 1:94014202-94014224 AAGGATGGAGGGAGGGATGGAGG + Intronic
911216982 1:95205421-95205443 CAGGTTTGAAGGAGAGATGGAGG + Intronic
912308548 1:108595749-108595771 CATGCTGGAGGGAGAGAGGAAGG + Intronic
912519540 1:110235596-110235618 CAGGCTGCTGGAAGAGGAGGGGG + Intronic
912798128 1:112705120-112705142 CAGGCTGCAGGAAGAGAGGGCGG + Exonic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
914355224 1:146879051-146879073 AAGGCAGGAGGGAGAGATGATGG - Intergenic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914816318 1:151065573-151065595 CAGGGTGTTGGGGGAGATGCTGG + Intronic
915120853 1:153628901-153628923 AAGGCTGGCAGGAGAGGTGGGGG - Intronic
915126741 1:153670762-153670784 TAGGATAGTGGGAGAGATGGAGG - Intronic
915164265 1:153939873-153939895 GAGGCTGGAGGTGGAGATGGAGG - Intronic
915170890 1:153976731-153976753 CTGGCTGGTGGAAGAGTTTGTGG - Exonic
915679595 1:157567787-157567809 CTGGCTGGTGGTAGGGAGGGTGG - Intergenic
915919221 1:159961749-159961771 CAGGCAGGGCCGAGAGATGGAGG + Intergenic
915936289 1:160092052-160092074 CAGGCTGTGGGCAGGGATGGGGG - Intronic
915940606 1:160116129-160116151 TGGGGTGGAGGGAGAGATGGAGG - Intronic
915961664 1:160272198-160272220 CACCATGGTGGCAGAGATGGAGG - Intergenic
916047193 1:161008928-161008950 CTTCCTGGTGGGAGAGAGGGAGG - Intronic
916722726 1:167496807-167496829 CAGGCTGGTGGCAGGGGTGTGGG + Intronic
916824001 1:168426952-168426974 GTGGCTGGTGGCAGAGAGGGTGG + Intergenic
916842324 1:168613268-168613290 CACGCTGCTGGGAGAGAGGCAGG + Intergenic
916941675 1:169684384-169684406 CAGGCAGGAGGGAAAGAAGGAGG - Intronic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917490480 1:175494089-175494111 CAGGCTGGTGGGAGGAATCCGGG - Intronic
918095047 1:181327538-181327560 CACCCTGGGGGGAAAGATGGGGG - Intergenic
918097597 1:181347756-181347778 CAGCCTGCTGGGTGGGATGGGGG + Intergenic
918987426 1:191651105-191651127 CAGGGTGGTGCGAGGGATAGTGG - Intergenic
919913371 1:202125647-202125669 CTGGGTGGTGGGACAGGTGGAGG + Intronic
919922317 1:202174036-202174058 CAGGCTGGTGGGGGGCAGGGTGG + Intergenic
919931443 1:202223857-202223879 CAGGCCGGTGGGAGAGGGGCTGG - Intronic
920043974 1:203121653-203121675 CAGGCTGGTTGGGGGGATGGGGG - Intronic
920213901 1:204348723-204348745 CAGCAGGGTGGGGGAGATGGCGG - Intronic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920376830 1:205513286-205513308 CAGGAGGATGGGGGAGATGGAGG + Intronic
920541773 1:206784292-206784314 CAGGCTGGGAGGAGAGATAGGGG - Intergenic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
921273482 1:213492998-213493020 CATGCTGCTGGTAGAGATCGTGG + Intergenic
922110212 1:222548541-222548563 CAAGGCGGTGGGAGATATGGAGG + Intergenic
922177820 1:223210858-223210880 CAGTCTGGTGGGGCATATGGAGG - Intergenic
922700616 1:227757913-227757935 TATGCTGGGGGGAGAGAAGGAGG - Intronic
922764318 1:228149558-228149580 CAGATGGGTGGGAGAGAAGGAGG + Intergenic
922845569 1:228681478-228681500 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
922935762 1:229421021-229421043 CAGGCTCCTGCGACAGATGGAGG - Intergenic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923170242 1:231409527-231409549 CTGTCTGATGGGGGAGATGGAGG - Intronic
923459952 1:234200528-234200550 GAGGCTCCTGGGAGAGATGATGG - Intronic
923568628 1:235095056-235095078 AAGGCAAGAGGGAGAGATGGAGG - Intergenic
924230494 1:241958288-241958310 CAGGCTGGTGCAGGAGCTGGAGG + Intergenic
924499854 1:244627142-244627164 GAGGCTGAGGGGAGAGATGCGGG + Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
1062963655 10:1591941-1591963 CAGGCTGGTGGGTGAGGTGAAGG - Intronic
1063086923 10:2828261-2828283 TAAGCTTGTGGGAGAAATGGAGG + Intergenic
1063388307 10:5630972-5630994 CAGGCAGCTGGCAGAGCTGGAGG - Intergenic
1064531375 10:16313942-16313964 GAGGCTGGTGGGATAAACGGAGG - Intergenic
1064598806 10:16972759-16972781 GGGGCTGGTGATAGAGATGGTGG - Intronic
1065116951 10:22492505-22492527 CAAGCTGGTGGAGGAGATGGAGG - Intergenic
1065169880 10:23016268-23016290 AAGGCTGGTGGGAGAAATACAGG - Intronic
1065229700 10:23584586-23584608 CAAGCTGGAGGGACAGATGGGGG - Intergenic
1065443301 10:25773350-25773372 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1066214986 10:33277494-33277516 CAGGCTGGTGGCAGCGCTGGTGG - Intronic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066383272 10:34919662-34919684 CAGGCTGGGGCCAGACATGGTGG + Intergenic
1066491534 10:35899412-35899434 CATACTGGGAGGAGAGATGGTGG + Intergenic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1067267343 10:44757328-44757350 GAGGGGGATGGGAGAGATGGAGG - Intergenic
1067267378 10:44757455-44757477 GAGGGGGTTGGGAGAGATGGGGG - Intergenic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069740659 10:70685121-70685143 CAGGCTGGTGAGAGTGATGGGGG + Intronic
1070300181 10:75197954-75197976 CAAATTGGTGGGAGAGATGGTGG + Intergenic
1070325179 10:75384210-75384232 CAGGAGGGAGGGAGAGAGGGGGG - Intergenic
1070675992 10:78411693-78411715 CAGGGTTGTGGGAGAGGTGAAGG - Intergenic
1070812981 10:79307490-79307512 CCGGGGGGTGGGAGAGCTGGGGG - Exonic
1070969781 10:80553674-80553696 AAGGTTGGAGGGAGTGATGGTGG + Intronic
1071143910 10:82544617-82544639 CAGGAGGGTGAGAGACATGGAGG + Intronic
1071444804 10:85735932-85735954 AAGGCAGGAGGGAGAGAAGGAGG + Intronic
1071487695 10:86113723-86113745 CAGGCCAGTGGGTGAGCTGGTGG + Intronic
1071810965 10:89180214-89180236 CAGACTGGAGGCATAGATGGTGG + Intergenic
1072598430 10:96898528-96898550 GATTCTGGTGGTAGAGATGGTGG + Intronic
1072634522 10:97169389-97169411 GATCCTGGTGGGAGAGAGGGTGG - Intronic
1072635822 10:97177175-97177197 CAGGTTGGAGAGAGAGATGGGGG - Intronic
1072762423 10:98067773-98067795 CAGTCTGGTGGGAGAGAAAAAGG - Intergenic
1073047973 10:100651571-100651593 CAAGGTGGTGGGAGTGGTGGAGG - Intergenic
1073709594 10:106021771-106021793 CAGGCAGGAGGGAAAGAAGGTGG + Intergenic
1074685912 10:115962295-115962317 CAGGGTGATGGCAGAGATGGGGG - Intergenic
1074705019 10:116122760-116122782 CTGGGAGGTGGGAGAGGTGGTGG - Intronic
1074777918 10:116779698-116779720 CAGGCAGGTGGGAGAGGTGAAGG + Intergenic
1075486842 10:122829423-122829445 CAGACTGCTGGGAGTGTTGGCGG + Intergenic
1075595289 10:123724895-123724917 CTGGGTGCTGGGAGAGAAGGTGG + Intronic
1075634301 10:124019857-124019879 CCGCCTGGTGTGGGAGATGGGGG - Intronic
1075955154 10:126517134-126517156 CAGACTAGTTGGGGAGATGGAGG + Intronic
1076117976 10:127913858-127913880 AAGGCTGGTGGATGAGGTGGGGG - Intronic
1076423511 10:130351176-130351198 CAGGGTGGGGGCAGAGATGAGGG + Intergenic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1076563501 10:131382501-131382523 CAGGCAGGTCAGAGAGAGGGAGG - Intergenic
1076601570 10:131660176-131660198 GAGTTTGGTGGGGGAGATGGTGG + Intergenic
1076610968 10:131725725-131725747 CAGGCATGTGGGAGAGAGGCAGG + Intergenic
1077204549 11:1336344-1336366 GAGGAGGGTGGGAGAGAGGGCGG - Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077417027 11:2428860-2428882 CATGGTGGTGGTAGTGATGGTGG + Intergenic
1077665114 11:4101244-4101266 AAGGAAGGTGGGAGAGTTGGAGG + Intronic
1078407992 11:11087898-11087920 CAGAGTGGTGGGTGAGATGAAGG - Intergenic
1078901293 11:15645013-15645035 CAGGTAGGAGGGAGAGAGGGAGG + Intergenic
1078920565 11:15826612-15826634 CTGGCTGGAGGGAGGAATGGGGG - Intergenic
1079075993 11:17385984-17386006 CAGGATGGTGGGAGGGACTGAGG - Exonic
1079096237 11:17512165-17512187 CAGAGTGGTGAGAGAGCTGGGGG - Intronic
1080655116 11:34252540-34252562 CAGGCAGGTTGGAGGGTTGGGGG - Intronic
1081159543 11:39735567-39735589 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1081606619 11:44531208-44531230 GAGGCGGGTGGTAGAGATGAGGG - Intergenic
1081753871 11:45531103-45531125 CAGGCTGGAGTGAGAGAGGAGGG + Intergenic
1082130762 11:48486414-48486436 CACGGTGGTGTGAGAGATGCAGG + Intergenic
1082261045 11:50076469-50076491 CAGGCTGCTGGGAGACAGGTAGG + Intergenic
1082564269 11:54657287-54657309 CATGGTGGTGTGAGAGATGCAGG + Intergenic
1082807820 11:57461352-57461374 CTCTCTGGTAGGAGAGATGGAGG + Intronic
1082807984 11:57462015-57462037 GTGGCTGGTGGGCCAGATGGGGG + Intronic
1083187638 11:61026862-61026884 TAGGCTGGAGGGGGAGAGGGTGG + Intergenic
1083200524 11:61118568-61118590 CAGGCTGGTGGAAGGGGTGGGGG + Intronic
1084020399 11:66413865-66413887 CAGGCTGGTGAGAGAGCAAGGGG - Intergenic
1084101466 11:66952387-66952409 CAGGCTGGCGGGATGCATGGGGG - Intronic
1084128952 11:67118980-67119002 CGGGCTGGCGGGAGGGAGGGAGG + Intergenic
1084353943 11:68624427-68624449 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1084369068 11:68726253-68726275 CTGGCTGGTGGGAGGGGAGGAGG + Intronic
1084476832 11:69394091-69394113 CCGGCTGCTGGGAGGGCTGGAGG + Intergenic
1084700957 11:70785794-70785816 CAGCCTGGTGCCCGAGATGGGGG - Intronic
1084708779 11:70831108-70831130 CAGGCGGGTAGCAGAGAGGGTGG + Intronic
1085618575 11:78020801-78020823 CAGGATGTTGGGAAGGATGGCGG - Intronic
1085707684 11:78801275-78801297 CATGGTGGTGGTAGTGATGGTGG - Intronic
1085734217 11:79025153-79025175 CAGGCTAGTGTGAGAGACAGAGG - Intronic
1085836613 11:79963378-79963400 GAGGATGGTGGTAGGGATGGAGG - Intergenic
1085934156 11:81123383-81123405 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1087411307 11:97793038-97793060 CAAGATGGTGGAAAAGATGGTGG + Intergenic
1088365608 11:109036971-109036993 CAGGCAGGAAGGAGAGAAGGAGG - Intergenic
1088798237 11:113282740-113282762 CAGGGAGGTGGGAGAGAATGTGG - Intergenic
1088800012 11:113296948-113296970 CAGGCTACTGTGAGAAATGGTGG - Intergenic
1089199531 11:116715501-116715523 CAGCCTGGCGGGAGCCATGGGGG - Intergenic
1089213612 11:116822393-116822415 CAGGCTCATGGAAGAGAGGGAGG - Intronic
1089290868 11:117437414-117437436 CAGGCCGGAGGGAGAGAGAGAGG + Intronic
1089311330 11:117560034-117560056 CCGGCTGCTGGGAGGGGTGGGGG + Intronic
1089377409 11:118004390-118004412 CAGGCTGGAGTGAAAGAAGGAGG + Intergenic
1089411927 11:118251224-118251246 CAGGCAGCTGGGAGGGATCGGGG + Intronic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1090387582 11:126365707-126365729 CAGGCTGGTGGGGCAGCTGGAGG + Intronic
1090390148 11:126382905-126382927 CAGGCTGGCGGGGCAGCTGGAGG + Intronic
1090398944 11:126436163-126436185 CAGCCGGGTGGGTGAGAGGGAGG - Intronic
1090805582 11:130200074-130200096 CAGCCAGTTGGGAGAGATGAGGG - Exonic
1091023451 11:132121730-132121752 TAGGCTGGTTCGAGAGAGGGGGG - Intronic
1091099939 11:132862629-132862651 CAGGCAGCTGAGAAAGATGGTGG + Intronic
1091183557 11:133628353-133628375 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1091305479 11:134533196-134533218 CAGGCTGCAGGGAGAGTGGGGGG + Intergenic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1092277172 12:7070212-7070234 TAGGCAGATGGGAGAGACGGTGG - Exonic
1093532696 12:20186286-20186308 CAGGTTGGTGGGCGTGATGAAGG - Intergenic
1094316168 12:29139180-29139202 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1095438062 12:42213355-42213377 CAGGCTTGTGAGAGAAAAGGTGG + Intronic
1095739569 12:45592573-45592595 GAGGCGGCTGTGAGAGATGGGGG - Intergenic
1096149057 12:49297371-49297393 CAGGCAGTTGAGAGAGCTGGAGG + Exonic
1096345535 12:50842938-50842960 GAGGCTGGTGAGCAAGATGGCGG - Exonic
1096347873 12:50866447-50866469 GAGGCTGCTGTGAGGGATGGGGG - Intronic
1096772114 12:53942005-53942027 TGGGCTGGTGTGGGAGATGGAGG + Intronic
1097169099 12:57102558-57102580 CAGGCAGGTGGGAGGGATGAAGG - Intronic
1097231153 12:57512066-57512088 CAGACCAGTGGGAGAGATGGTGG + Exonic
1098066112 12:66618412-66618434 CTGGCTGGTGGGGGATATGGAGG + Intronic
1098187766 12:67916327-67916349 CAAGCTGGTGGGAGTGGGGGTGG - Intergenic
1099423660 12:82495875-82495897 CAGGCTGGTTGGGGAGATGTTGG + Intergenic
1099872632 12:88368872-88368894 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1100370807 12:93967050-93967072 AAGGATGGCGGGAGGGATGGAGG - Intergenic
1101603876 12:106233292-106233314 CACGGAGGTGGGGGAGATGGGGG - Intergenic
1101944987 12:109129894-109129916 CAGGCAGGTGATAGTGATGGCGG - Intronic
1102084558 12:110125006-110125028 CAGGCTGGTGGGCGACTTGGGGG + Intronic
1102144807 12:110646824-110646846 GAAACTGGTGGGAGGGATGGAGG - Intronic
1102183479 12:110930789-110930811 CGGGCTGGAGGGTGAGGTGGGGG - Intergenic
1102219850 12:111187215-111187237 CAGGCTGCTGGGTGATATGGAGG - Intronic
1102402881 12:112646066-112646088 TAGTCTGGTGGGAGAGTTGCAGG + Intronic
1102473687 12:113175020-113175042 CGGGCTGGTGCGTGAGCTGGGGG - Exonic
1103004462 12:117409758-117409780 CAGGCTGCTGGGGAAGTTGGAGG - Intronic
1103274103 12:119697255-119697277 CAGCCCAGTGGGAGAGATGCTGG - Intronic
1103463719 12:121125088-121125110 AAGGCAGGTGGGTGGGATGGTGG - Intergenic
1104310471 12:127650321-127650343 CAGCCTGGCTGGAGAAATGGTGG - Intergenic
1104428535 12:128697484-128697506 CAGGGTGGAGTGAGAAATGGGGG + Intronic
1104437487 12:128767381-128767403 CAGGCAGGGGGGAGGGAGGGAGG + Intergenic
1104576924 12:129974438-129974460 CATTCTGGTTGGAGGGATGGAGG - Intergenic
1104807553 12:131599117-131599139 AAGGCTGATGGGAAAGATGCAGG - Intergenic
1104858418 12:131912664-131912686 CATGCTGATGGGAGAGGCGGAGG - Intronic
1105032058 12:132890884-132890906 CAGGCAGGAGGGAGAGAAGGAGG - Intronic
1105257396 13:18753199-18753221 TAGAATGGTGGGAGAGTTGGGGG - Intergenic
1105257408 13:18753249-18753271 TAGAATGGTGGGAGAGTTGGGGG - Intergenic
1105298987 13:19116723-19116745 CAGGCTGGAGGAGGAGAAGGAGG - Intergenic
1105786904 13:23759259-23759281 CATGCTGGCTGGAGAGATGTAGG - Intronic
1105902131 13:24764367-24764389 CAGCCTGGAGGGAGCGCTGGGGG + Intronic
1106128586 13:26921071-26921093 CACGCTGGAGGGAGAGAGGCAGG + Intergenic
1107527899 13:41251517-41251539 CATGCTGGTGGGAGAGGTCTTGG - Intronic
1107725979 13:43299669-43299691 GAGAGTGGTGGGAGAGTTGGTGG - Intronic
1107727958 13:43318962-43318984 CAACCTGGAGGGAGAGAGGGAGG + Intronic
1108280136 13:48852911-48852933 CAGGCTGGGGGTAGAGAGGGTGG + Intergenic
1108579955 13:51819568-51819590 AAGGTTAGTGGGAGAGAAGGGGG - Intergenic
1109982885 13:69933717-69933739 TAGGCTGGAGGCAGAGACGGTGG - Intronic
1110015280 13:70392470-70392492 CAGGGTGGTGGGATAGAAGGTGG - Intergenic
1110735746 13:78934479-78934501 CAGGCGGGTGTGAGAGAGCGGGG + Intergenic
1110845233 13:80185226-80185248 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1113616742 13:111685657-111685679 CAGGCTGGTGGGAGTGCAGGTGG - Intergenic
1113622272 13:111770928-111770950 CAGGCTGGTGGGAGTGCAGGTGG - Intergenic
1113666175 13:112143325-112143347 CAGACTGCTGGGAGAGAGGGAGG + Intergenic
1113717870 13:112526510-112526532 CATGGTGGTGGCAGTGATGGTGG - Intronic
1116250503 14:42475713-42475735 CAGGCTGGTGGGAAAAATTTTGG - Intergenic
1116703399 14:48266515-48266537 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1116859040 14:49979094-49979116 CAGGCCAGAGGGAGTGATGGTGG - Intergenic
1117224950 14:53647036-53647058 CTGGCTGCTGGGGAAGATGGTGG + Intergenic
1117964262 14:61190634-61190656 CAGGGTGGTGGGAGACAGGCTGG - Intronic
1118937408 14:70300335-70300357 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1119195781 14:72715815-72715837 GAGACTGGTGGGAGGGAGGGAGG - Intronic
1119462996 14:74826744-74826766 CAGTCTGGTGGGACTGAAGGTGG - Intronic
1119659086 14:76437862-76437884 CATGCTGGTGGAGGAGAAGGCGG - Intronic
1121114951 14:91336951-91336973 CTGGCTGGTAGGAGAGACGTTGG + Intronic
1121511522 14:94516364-94516386 CAGGCTGGAGTGACAGATGTGGG - Intronic
1121533916 14:94678009-94678031 GAGGCTGGTGTGGGCGATGGTGG - Intergenic
1121712845 14:96052301-96052323 CAGGCTGGTGCCAGAGGTGGGGG + Intronic
1121835312 14:97086994-97087016 CAGTCTGGTGGAAAAGATGGAGG - Intergenic
1122165696 14:99822026-99822048 CAGCCTGGTGTGTGAGATGAGGG + Intronic
1122194501 14:100074891-100074913 CAGGCTGAGGGGAGACAGGGTGG + Intronic
1122635946 14:103129758-103129780 CAAGCTGGTGGGTGAGCTGCAGG + Exonic
1122817820 14:104322172-104322194 AAGACTGGAGGAAGAGATGGGGG - Intergenic
1122859761 14:104577335-104577357 CCGGTGGGTGGGGGAGATGGGGG - Intronic
1202902969 14_GL000194v1_random:53844-53866 CAAGCTGGTGAGTGAGGTGGAGG - Intergenic
1123996370 15:25720632-25720654 GAGGCTGGTGGGAGGGAGGATGG + Intronic
1124835686 15:33194395-33194417 CAGCTTGGTGGGGGAGCTGGAGG + Intronic
1125358674 15:38843073-38843095 CAGGCTGGTAGGAGGGATTCTGG + Intergenic
1125504670 15:40260202-40260224 AAAGCTGGTGGGAGTGACGGCGG - Intronic
1125629056 15:41132690-41132712 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1125832963 15:42729265-42729287 CAGGCTGGTGGTAGTGGTGGGGG + Exonic
1125863515 15:43020358-43020380 CAGTCTGATGGGAGAGATGAAGG - Intronic
1126847783 15:52777356-52777378 CAGATTGGAGGGAGAGAAGGGGG - Intronic
1127298972 15:57634176-57634198 CAGGCTGGTGAGTGTGGTGGGGG + Intronic
1128109712 15:65068489-65068511 CAGGCTTCTGGGAGAGGGGGCGG + Intronic
1128128390 15:65209749-65209771 CGGGCTTGGGGGAAAGATGGTGG - Exonic
1128147484 15:65340056-65340078 CAGGCTGAGGGGAGAGACAGAGG + Intronic
1128368815 15:67024185-67024207 CAGGCTTGGGGGAGGGGTGGTGG + Intergenic
1128525188 15:68407569-68407591 CAGGCTGATTGCAGAGATGTTGG + Intronic
1128682938 15:69664698-69664720 CGGGCTGGGGGGTGAGGTGGGGG - Intergenic
1129108956 15:73326454-73326476 CTGGCTGGTTACAGAGATGGAGG + Intronic
1129681490 15:77660865-77660887 CAGGCGGGAGGGATGGATGGAGG + Intronic
1129857836 15:78837657-78837679 CAGGCTGCTGTGAGAGGTGGGGG - Intronic
1129884993 15:79031513-79031535 CGGGCAGGTGGGAGAGGTGAGGG + Intronic
1130304442 15:82703764-82703786 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
1130760351 15:86813163-86813185 CAGGCTGATGGGAGTAATGATGG + Intronic
1130846977 15:87756730-87756752 CTGGCTGCTGGGAGAAATGCTGG - Intergenic
1130963660 15:88681760-88681782 CCGGCTGGAGAGAGAGAGGGCGG - Intergenic
1131219493 15:90570289-90570311 CAGGTGGGTGTGAGGGATGGAGG + Intronic
1131268353 15:90932024-90932046 CAGGCTCCTGGCAGAGAAGGGGG + Intronic
1131402343 15:92135163-92135185 AAAGCTGGAGGGAGAGATGGAGG + Intronic
1131578271 15:93614042-93614064 GAGGGAGGTGGGAGAGAGGGCGG + Intergenic
1131753227 15:95532425-95532447 CAGCCTGGTGGGAGGGCTGGGGG - Intergenic
1131923338 15:97354259-97354281 CAGGCAGGAGAGAGACATGGAGG - Intergenic
1131951397 15:97685058-97685080 CAGGCTGGTGTGAGACATACAGG - Intergenic
1132019914 15:98351899-98351921 CAGGCTGGTGGCAGATATGGAGG + Intergenic
1132169464 15:99634232-99634254 GAAGTTGGTGGGAGAGATGAGGG + Intronic
1132518030 16:374946-374968 CAGCCTGTTGGGAGCGCTGGTGG - Intronic
1132593911 16:739600-739622 CAGCCGGGCAGGAGAGATGGTGG + Intronic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1132664613 16:1075915-1075937 CAGGGTGGGGGGAGAGAGGGAGG - Intergenic
1132664758 16:1076291-1076313 CAGGGTGTGGGGAGAGAGGGAGG - Intergenic
1132693934 16:1193835-1193857 CAGGCTGGAGTGACAGGTGGGGG + Intronic
1132752747 16:1466302-1466324 GAAGGTGGAGGGAGAGATGGGGG - Intronic
1132931270 16:2460280-2460302 CAGGCTGGTGGCCGAGCTGCAGG + Exonic
1132984617 16:2758251-2758273 CAGGCTGCTTGGAGAGGTGGAGG + Intronic
1133050132 16:3112776-3112798 CAAGCTGGCAGGAGAGAAGGGGG + Exonic
1133128671 16:3663053-3663075 CATCCTGGTGGGAGAGGAGGTGG - Exonic
1133402449 16:5498641-5498663 TAGGCTGTTGGGAGAGAAGATGG + Intergenic
1133839233 16:9393853-9393875 CAGGCTGGTGAGAAAGATGGAGG + Intergenic
1133869713 16:9675635-9675657 CAGGCGGGAGGGAAAGAAGGAGG + Intronic
1134011763 16:10859232-10859254 CATGATGGTGGTAGTGATGGTGG + Intergenic
1134082313 16:11333587-11333609 CCAGCTGCTGGGAGAGCTGGTGG + Intronic
1135088981 16:19497464-19497486 CAGTCTGGTGGGAAAGACTGAGG + Intronic
1135912059 16:26570515-26570537 GTGGGTGGAGGGAGAGATGGTGG - Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136236912 16:28919940-28919962 GAGTCTGGTGGGGGAGAGGGAGG + Exonic
1136279897 16:29202195-29202217 CAGGCTGTTGGGAAAGATGCTGG + Intergenic
1136279927 16:29202365-29202387 CAGGCTGTTGGGAAAGATGCTGG + Intergenic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1136544219 16:30946960-30946982 CAGGCTGGCAGGACGGATGGGGG - Intronic
1137974972 16:53023520-53023542 CAGGCTGGAGGGACAGCTGAGGG + Intergenic
1138288897 16:55830843-55830865 CAGGCAAGTGGGAGTGAGGGAGG + Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139355571 16:66365396-66365418 CAGGCTGGTGGGGGAGACAGGGG - Intergenic
1139374176 16:66486620-66486642 CAGGCAGGGAGGGGAGATGGAGG - Intronic
1139670699 16:68491022-68491044 AGGGGTGGTGGGAGGGATGGGGG + Intergenic
1140199126 16:72880170-72880192 GAAGGTGGTGGGAGAGATGAAGG - Intronic
1140310592 16:73844595-73844617 CATGCTCGAGGGAGGGATGGGGG + Intergenic
1140693429 16:77507530-77507552 CAGGGTGGAGGGAGAGCAGGGGG + Intergenic
1141028417 16:80568689-80568711 GAGGAGGGTGGGAGAGGTGGGGG - Intergenic
1142084289 16:88168303-88168325 CAGGCTGTTGGGAAAGATGCTGG + Intergenic
1142225942 16:88877705-88877727 CAGGGTGGGGGCAGAGGTGGAGG - Intronic
1142743108 17:1942045-1942067 GAGGCTGGTGGGAGGGGTGCAGG - Intronic
1143090326 17:4446106-4446128 CAGGACGGTGGGCGCGATGGTGG - Exonic
1143387592 17:6541114-6541136 CATGCTGGAGGAAGAGATGCAGG - Intronic
1143528356 17:7485072-7485094 CTGGCTGGAGGGTGAGAAGGAGG + Intronic
1143740677 17:8951404-8951426 GAGGCTGGGGGGAGAAGTGGCGG - Intronic
1143769219 17:9157403-9157425 CAGGTTGGTGGGAGAGGGAGAGG + Intronic
1143918511 17:10312648-10312670 GAGGCTGCAGGGAGAGGTGGAGG - Exonic
1143992544 17:10978768-10978790 CACACTGCTGAGAGAGATGGTGG - Intergenic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1145059126 17:19721204-19721226 CTGTCTGGTGGGAGACCTGGGGG - Intergenic
1146646787 17:34581489-34581511 CCGGCTGCAGGGAGAGACGGGGG - Intronic
1146714522 17:35073477-35073499 AAGACTGGTGGGAGAGATGGTGG + Intronic
1146714579 17:35074244-35074266 AAGACTGGTGGGAGAGATGGTGG - Intronic
1146896529 17:36545412-36545434 CGGGCGGGCGGGAGAGAGGGAGG + Intronic
1146928441 17:36761553-36761575 GAGGGTGCTGGGAGAGGTGGAGG - Intergenic
1147548608 17:41422335-41422357 CAGGGTGTTGGGGGAGATGCGGG - Exonic
1147550556 17:41438759-41438781 CAGGGTGCTGGGGGAGATGCGGG - Exonic
1147588198 17:41665209-41665231 CAGTCTGGTGGGAGAGTGAGGGG - Intergenic
1148083905 17:44982723-44982745 GATGGTGGTGGTAGAGATGGTGG + Intergenic
1148200861 17:45749281-45749303 GAGGCTGGATTGAGAGATGGTGG - Intergenic
1148291971 17:46460140-46460162 CAGGCTAGTGGGAGTAATGGGGG + Intergenic
1148314161 17:46677831-46677853 CAGGCTAGTGGGAGTAATGGGGG + Intronic
1148334282 17:46831445-46831467 CACGTTGGAGGGAGAGGTGGAGG + Intronic
1148809460 17:50280704-50280726 CAGGCAGGTGGCAGAGCTGGGGG + Exonic
1149070456 17:52536251-52536273 CATCCTGGAGAGAGAGATGGAGG - Intergenic
1149556817 17:57579376-57579398 CTGGGTGGTGGGAGAGGCGGTGG + Intronic
1149827030 17:59838045-59838067 CATGTTGGTGGGAGAGATTTTGG + Intronic
1149993109 17:61393642-61393664 CATGTTGGGGGCAGAGATGGAGG + Intergenic
1150121111 17:62603652-62603674 TAGTCTGTTGGGAGAAATGGTGG + Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150259031 17:63773672-63773694 CAGCCGGGCGGGAGAGAGGGAGG - Exonic
1150462426 17:65363914-65363936 CGGGGTGGTGGGGGAGAGGGAGG - Intergenic
1150752116 17:67873897-67873919 AAGGCTCCTTGGAGAGATGGTGG + Intronic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151569541 17:74919422-74919444 CAGCCTGGCGGGGGGGATGGAGG - Intronic
1151622376 17:75254122-75254144 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
1151678270 17:75610881-75610903 CAAGCTGTTGGAAGAGATGTGGG - Intergenic
1151684681 17:75639645-75639667 TGGGCTGGTGGGAGAGGTTGGGG + Exonic
1151699511 17:75735866-75735888 TAGGATGGAGGCAGAGATGGAGG + Intronic
1151814433 17:76464494-76464516 CAGGCTGGGTGGAGAGACAGGGG + Intronic
1151885800 17:76922759-76922781 CAGGAAGGTTGGAGGGATGGAGG + Intronic
1151952243 17:77361470-77361492 CAGGCAGGTGGGATCGAGGGTGG + Intronic
1152375038 17:79914583-79914605 CAGGCTGGTGGAAGGGAGGAAGG - Intergenic
1152450910 17:80379286-80379308 CAGGCTAGTGTGATAGATGGAGG + Intronic
1152496637 17:80677515-80677537 GAGTCTGGTGGGAGGGAAGGTGG - Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152540256 17:80971219-80971241 CAGGCTGGCGGGGGAGGGGGTGG - Intergenic
1152573900 17:81131908-81131930 AAGGCTGCTGGGGCAGATGGCGG - Intronic
1152800359 17:82328007-82328029 CAGGGTGGTGGGGGGGCTGGTGG - Intronic
1153013781 18:565199-565221 CAGGCTGGCAGGGGAGGTGGGGG + Intergenic
1155194248 18:23458339-23458361 CAGGCAGGTGGGGGAGAATGCGG + Intronic
1155990572 18:32275129-32275151 AAGGGTGGTGGTAGAGTTGGTGG - Intronic
1156003477 18:32412461-32412483 CGTGCTGGTGGTAGATATGGTGG - Intronic
1156302140 18:35845439-35845461 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1156474785 18:37398595-37398617 CAGGGAGGAGGGTGAGATGGAGG - Intronic
1157098790 18:44711258-44711280 CAGGAGGGAGGGAGAGAGGGAGG - Intronic
1157274505 18:46301394-46301416 CAGGTGTGTGGGGGAGATGGCGG + Intergenic
1157580853 18:48773465-48773487 CTGGCTGGTGGGGGTGGTGGTGG - Intronic
1157714821 18:49876836-49876858 GAGGGTGGAGGGAGAGAAGGAGG - Intronic
1157830644 18:50854246-50854268 CAGTGTGGTGGGTGAAATGGGGG + Intergenic
1157906510 18:51574213-51574235 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1158266897 18:55669238-55669260 GAGGCTGATGGGAGAGAATGGGG + Intergenic
1158426468 18:57344581-57344603 CAGGCTCAGAGGAGAGATGGAGG - Intergenic
1158488844 18:57892196-57892218 GAGGCTGGGAGGAGAGAGGGGGG - Intergenic
1158783279 18:60677762-60677784 CAGGGTGTTGGCAGAGTTGGGGG + Intergenic
1159531522 18:69661531-69661553 CAGTCAGGTGTGAGAAATGGTGG + Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159899913 18:74036425-74036447 CTGGCTGATGGCAGGGATGGAGG - Intergenic
1160543734 18:79639261-79639283 CAGGCTGGTGAGGGAGTGGGGGG + Intergenic
1160742667 19:694731-694753 CAGGCTGGTGGGGGAGCTGGGGG - Intronic
1160756627 19:760708-760730 CAGGAGGGAGGGAGGGATGGAGG + Intronic
1160851596 19:1195452-1195474 CAGCCTGGAGGAAGAGATGGAGG + Intronic
1160852020 19:1197266-1197288 CAGCCTGGAGGAAGAGATGGAGG + Intronic
1160890680 19:1377270-1377292 CAGGCGGGCGGGGGAGGTGGAGG - Exonic
1161303940 19:3556804-3556826 CTGGGTGGTGGGACTGATGGAGG + Intronic
1161329324 19:3678768-3678790 CAGGACGGAGGGAGGGATGGAGG + Intronic
1161329357 19:3678870-3678892 CAGGATGGAGGGAGGGATGGCGG + Intronic
1161329390 19:3678976-3678998 CAAGATGGAGGGAGGGATGGAGG + Intronic
1161338918 19:3730155-3730177 CAGGCTGGGGTCAGAGATGCTGG - Intronic
1161399811 19:4062239-4062261 CCTGCTGGGGGGACAGATGGAGG + Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161493700 19:4576226-4576248 CAGGGAGGTGGGAGCCATGGAGG - Intergenic
1161534707 19:4811912-4811934 CAGGCGGGTGGGAGCCATGCAGG - Intergenic
1161580343 19:5077421-5077443 CAGGATGATGGGCGAGATGAGGG - Exonic
1161591131 19:5129571-5129593 CAGCCTGTTGGGGGAGGTGGAGG + Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161627360 19:5335118-5335140 CAGGCTGTGGGGAGAGAGGCTGG - Intronic
1161678333 19:5665984-5666006 CAGGGTGAAGGGAGAGATGGCGG - Intronic
1161903196 19:7135161-7135183 CAGTCTGGTGGCAGGGGTGGGGG + Intronic
1162086563 19:8253113-8253135 CAGGATGTTAGGAGGGATGGTGG + Intronic
1162180769 19:8867320-8867342 GAGGATGGATGGAGAGATGGAGG + Intronic
1162625224 19:11879797-11879819 CTGGCTGGTTGGAGAGAGGGTGG - Intronic
1162630459 19:11923563-11923585 CAGGCTGGTGGGAGAGAGGGTGG - Intergenic
1162634063 19:11952764-11952786 CAGGGCAGTGGCAGAGATGGGGG + Intronic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163640497 19:18459266-18459288 CAGGCTGGTTGTAGGGAAGGTGG - Intronic
1163900389 19:20095142-20095164 CAGGCGGGAGGGAAAGAAGGAGG + Intronic
1164458257 19:28426906-28426928 CAGGAGGGTGGGAGGGGTGGAGG + Intergenic
1164473786 19:28556798-28556820 AAGGCTGTGGGGGGAGATGGGGG - Intergenic
1164730967 19:30504302-30504324 GAGGCTGGTGGGAGGGAGGAAGG - Intronic
1164762623 19:30739332-30739354 CAGGCTTGTGGGTGAGGAGGGGG - Intergenic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165092424 19:33394115-33394137 CAGGCTGTTGGGAGACCTGAGGG - Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165816826 19:38647716-38647738 CAGGCTGGTGGGCGAGCGAGAGG + Exonic
1166617824 19:44267019-44267041 CAGGCTGGTGGCTGAGGAGGTGG - Intronic
1166643900 19:44516980-44517002 CAGGCCAGTGAGAGAGTTGGAGG + Exonic
1166667924 19:44692418-44692440 CCGGGGGGTGGGAGAGTTGGTGG - Intergenic
1166791325 19:45400371-45400393 CAGGGAGGTGGCAGAGCTGGTGG - Intronic
1166852058 19:45765819-45765841 CAGGCTGGTGCTGGAGGTGGTGG + Exonic
1166852115 19:45766008-45766030 CATGCTGGTGGGGAAGGTGGCGG + Exonic
1167099305 19:47394247-47394269 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1167148695 19:47696783-47696805 CAGCCGTGTGGGAGACATGGAGG - Intronic
1167212137 19:48139884-48139906 CAGGTGGATCGGAGAGATGGTGG - Intronic
1167524214 19:49973476-49973498 GAGTCTGTTGGGAGAGATGGAGG - Intergenic
1167571371 19:50290955-50290977 GAAGCTGGAGGGAGAGCTGGAGG + Exonic
1167786731 19:51643709-51643731 CAGGTTGGTGGGAGGGACTGAGG - Intronic
1168248020 19:55124079-55124101 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1168300920 19:55404585-55404607 CAGTCTGTTGGCAGAGTTGGCGG - Intronic
1168329614 19:55559645-55559667 TAGACTGGTGGGGGAGATGGAGG + Intergenic
1168339693 19:55615871-55615893 CGGGCTGGCGGGGGAGGTGGGGG + Exonic
925126489 2:1461038-1461060 CAGACAGGTGGGACAGTTGGGGG + Intronic
925151035 2:1615070-1615092 CAGGTTGCTGGGAGAGGTGAGGG + Intergenic
925180297 2:1813174-1813196 CAGGTGGGGGGGAGAGAGGGAGG + Intronic
925357387 2:3251601-3251623 GTGACTTGTGGGAGAGATGGTGG - Intronic
925910465 2:8570445-8570467 CACCCTCCTGGGAGAGATGGGGG + Intergenic
925969265 2:9095703-9095725 CAGGGTGGTGGCAGGGGTGGTGG - Intergenic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926581131 2:14633659-14633681 CAGGCTGGCTGGAGAGCTTGCGG - Intronic
926689858 2:15725712-15725734 CAGGCTGCTGGGAGAGGAGCAGG + Intronic
927134053 2:20083864-20083886 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
927199668 2:20570560-20570582 CAGGATGGTGGGAGAGAGATGGG + Intronic
927936253 2:27078503-27078525 CACGATGGTTGGAGAGGTGGGGG + Intergenic
928232498 2:29510980-29511002 AGGGCTAGTGAGAGAGATGGTGG - Intronic
928403983 2:31000177-31000199 CAGGGTTTAGGGAGAGATGGTGG - Intronic
929248801 2:39730590-39730612 CAGGCTGGTGGCAGTATTGGTGG + Intergenic
929778064 2:44940909-44940931 CAGGGTGGTGGGGGAAATCGAGG + Intergenic
929858007 2:45651870-45651892 CAGGGAGGGGGGAGAGCTGGGGG - Exonic
929875776 2:45795233-45795255 CGGGGTGGTGGGAGAGTTGAGGG - Intronic
930057074 2:47260263-47260285 TGGGCTGGTGGTAGAGTTGGAGG + Intergenic
930108604 2:47658970-47658992 CAGGCAGGAGGGGGAGACGGTGG - Intergenic
930948904 2:57112896-57112918 CTGGCTTGTGGGTGAGATTGTGG - Intergenic
931077355 2:58730915-58730937 GAGGCTGATGGGAGAGATAAGGG - Intergenic
932436101 2:71703333-71703355 AAGGGAGGAGGGAGAGATGGTGG + Intergenic
932564671 2:72898376-72898398 CAGGCTGGTGGGGGAGAGGGTGG + Intergenic
932564970 2:72900491-72900513 CAGCGTGCTGGGAGAGAGGGAGG - Intergenic
933026276 2:77263254-77263276 CAGCCAGATGGGAGAGATGCAGG - Intronic
933559917 2:83876357-83876379 CAGTTTGGTTGGAGAGAGGGAGG + Intergenic
934503694 2:94876550-94876572 CAGGCTGTTGAGTGAGGTGGAGG + Exonic
934927798 2:98393758-98393780 CAGGAAGCTGGGAGAGAGGGAGG + Intronic
935349485 2:102141582-102141604 CAGGCTGGAGGAAAAGATGAAGG - Intronic
936229180 2:110685019-110685041 CAGACTGGGAGGAAAGATGGAGG + Intergenic
937072207 2:119073116-119073138 CAGGCAGGAAGGAGGGATGGAGG + Intergenic
937229953 2:120392324-120392346 GAGGCTTGTGAGAGGGATGGCGG + Intergenic
937336640 2:121066279-121066301 CAGGCAGGTGAGGGAGAAGGAGG + Intergenic
937887778 2:126911728-126911750 CAGGCGGGTGGCAGAGCTAGGGG + Intergenic
937901208 2:127020583-127020605 CAGGGTGGTGGGTGAGGTGGTGG - Intergenic
937987513 2:127644791-127644813 CAGGCTGGTTGGAAAGGTGGTGG - Intronic
938092110 2:128440907-128440929 CAGGCTGCTGGGAGGGCTGCCGG - Intergenic
938239904 2:129735503-129735525 CATGGTGGTGGTAGTGATGGTGG + Intergenic
938911463 2:135889252-135889274 TAGGCAGGTGGCAGGGATGGAGG - Intergenic
939460846 2:142494009-142494031 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
939920156 2:148100203-148100225 CAGGCTGAAGGAAGAGTTGGAGG + Intronic
939957815 2:148541254-148541276 CTGGGTGGTGGCAGCGATGGTGG + Intergenic
940504774 2:154539180-154539202 CAGGCAGCGGAGAGAGATGGTGG - Intergenic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
941156709 2:161988002-161988024 AAGGCTGGGCGGAGAGAAGGTGG - Intergenic
941456301 2:165714636-165714658 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
941485894 2:166081764-166081786 CAGGTTGTAGGGAGAGACGGGGG - Intronic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
942668699 2:178350449-178350471 CAGCCTGGTGGAAAAGAAGGGGG + Intronic
942905020 2:181169770-181169792 CTGACTGCTGGGAGAGAAGGGGG - Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
942981377 2:182087303-182087325 CAAGCTGGTGGGAGAGTGGCAGG - Intronic
943220959 2:185105339-185105361 CAGGCTGCTGGGAGGAAGGGGGG - Intergenic
943450015 2:188034774-188034796 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
944927713 2:204482130-204482152 CAGGCTTGTGGGAGAGGAGGAGG - Intergenic
944968179 2:204960284-204960306 CAGGCTGAATGGAGAGGTGGTGG - Intronic
945036288 2:205706734-205706756 CAGGCTGCTGGGTTAAATGGTGG + Intronic
945812774 2:214568843-214568865 CAGGCTGTTGGGAGAAGAGGAGG - Intronic
945867416 2:215191686-215191708 CAGGATGGGAGGAGAGAGGGAGG + Intergenic
946022573 2:216651228-216651250 CATGCTGGTGGGAGGGAGGGAGG - Intronic
946373447 2:219294545-219294567 CAGGCGGGAGTGAGAGACGGAGG + Intronic
946412343 2:219521624-219521646 CAGGCAGGAGGGAGTGAAGGGGG + Intronic
947703733 2:232257511-232257533 CAGGCTGTTTGGAGTGACGGAGG - Intronic
947727885 2:232410957-232410979 CAGGAGGGTGGGGGACATGGGGG + Intergenic
947825910 2:233105839-233105861 CTGGCTTGTTGGAGAGATGGTGG + Intronic
947879069 2:233489294-233489316 CTGGCTGGTGTGAGGGATGGAGG - Intronic
948227599 2:236323546-236323568 CAGGCTGGGGGGTGTGCTGGTGG + Intergenic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948261363 2:236606680-236606702 CAGGCATGTGGCAGAGAGGGAGG - Intergenic
948414343 2:237791429-237791451 CAGGCTGGTGGCATAGATGAAGG - Intronic
948567632 2:238896821-238896843 CAGGCTGGTGAGTGACAAGGAGG - Intronic
1168750289 20:277192-277214 CAGTCTGGTGGGAGAGGGGCAGG + Intronic
1170134935 20:13062207-13062229 AAGCCTGGTGGGGGAGATGGGGG - Intronic
1170219610 20:13928325-13928347 CAGGGAGGTGGGAGAGCAGGAGG + Intronic
1170337519 20:15286617-15286639 CAGGCTGGAGAGAGAGAAGTGGG + Intronic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1170677608 20:18497015-18497037 CAGCCTGGAGGGAGGGACGGCGG - Intronic
1171123357 20:22583481-22583503 TATGCTGGTGGGAGAGTTTGGGG - Intronic
1171185579 20:23121881-23121903 CAGGATGGTGGGGGTGGTGGGGG + Intergenic
1171489322 20:25505312-25505334 CTGGGTGGTGGGGGAGATGCTGG + Intronic
1172186211 20:33032621-33032643 AAGGTGGGTGGGAGAGAAGGTGG - Intronic
1172628180 20:36360676-36360698 CAGACTGGTGGAAGAGTGGGTGG + Intronic
1172877373 20:38173491-38173513 CAGCCTTGTGGGAGGGATGTAGG - Intergenic
1172932635 20:38597241-38597263 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1173315941 20:41943077-41943099 CAGGCTGCTAGTAGAGCTGGAGG + Intergenic
1173380154 20:42532752-42532774 CAGGGTCGTGGGAGAGATGTTGG - Intronic
1173686087 20:44924334-44924356 AAGGCTGCTGGGCGAGAGGGTGG - Intronic
1173755848 20:45515469-45515491 CAGGCTGGGGGGCGGGGTGGTGG - Intronic
1173781566 20:45760984-45761006 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
1173946130 20:46952288-46952310 GAGGCCAGTGTGAGAGATGGAGG + Intronic
1174974796 20:55319738-55319760 CAGGGTGGTAGGAGTGGTGGAGG + Intergenic
1175009276 20:55718551-55718573 CCAGCTGCTGGGAGTGATGGTGG - Intergenic
1175127227 20:56761538-56761560 GATGATGGTGGTAGAGATGGTGG + Intergenic
1175131692 20:56794307-56794329 TGGGATGGTGGGAGAGGTGGTGG - Intergenic
1175132826 20:56802421-56802443 CAGGCTGGTGGCAGGGATTAAGG - Intergenic
1175169752 20:57071941-57071963 CAGGCTGGAGGGGGAGGTGGAGG - Intergenic
1175173099 20:57093335-57093357 GAGGCTGGTGGGAGGGTGGGTGG + Intergenic
1175205891 20:57310882-57310904 CCAGCTGGTGGCATAGATGGGGG - Intergenic
1175220696 20:57414872-57414894 CAGGCTGCTGGGAGAGTTTAGGG - Intergenic
1175441550 20:58995847-58995869 AAGGCTGGCCTGAGAGATGGAGG - Intronic
1175463447 20:59172530-59172552 CATGCCGCTGGGAGAGTTGGAGG + Intergenic
1175640339 20:60624281-60624303 CAGGCTGGTGGCTCAGATGGTGG - Intergenic
1175681209 20:60990086-60990108 CAGGAGGCAGGGAGAGATGGTGG + Intergenic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175834187 20:61982859-61982881 CAGGCTGGGAGGAGCCATGGAGG - Intronic
1175946227 20:62560117-62560139 CAGGCTGGGGGGAGGCAGGGCGG - Intronic
1175971931 20:62690854-62690876 CGGGCAGGTGGGTGAGATGTGGG - Intergenic
1176197292 20:63843420-63843442 CGGACTGGTGGGAGAGACGGAGG - Intergenic
1176622332 21:9068611-9068633 CAAGCTGGTGAGTGAGGTGGAGG - Intergenic
1176932131 21:14826407-14826429 GAGGGTGGTGGCAGAAATGGTGG - Intergenic
1177151950 21:17464119-17464141 CAGGCTGGTAGCAGAGCTGGAGG - Intergenic
1178001085 21:28162735-28162757 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1178427754 21:32492370-32492392 CAGGATGGGAGGAGAGATGCAGG + Intronic
1178584744 21:33862579-33862601 AAGGCTTGAGGGCGAGATGGCGG + Intronic
1178724341 21:35037629-35037651 TAGGCTGCTGGGAAAGGTGGAGG - Intronic
1178738065 21:35170723-35170745 CTGGTGGGTGGGAGAGCTGGTGG + Intronic
1179056787 21:37943801-37943823 CAGGCTCAGGGGAGAGATGGAGG - Intergenic
1179245748 21:39632759-39632781 CATTCTGGTGGTAGGGATGGGGG + Intronic
1179278780 21:39916016-39916038 CAGGCTGATTGGAGGGATAGAGG - Intronic
1179380479 21:40894688-40894710 TTGGCTGGTGGGAGTGGTGGAGG - Intergenic
1179650481 21:42805201-42805223 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1179838548 21:44054780-44054802 CAGGCTAGTGGGAGGGATAGAGG + Intronic
1180598226 22:16993864-16993886 CAGGCTGGTGGGTGTGGAGGCGG - Intronic
1180793886 22:18592427-18592449 CAGGTTGGGGGCAGAGCTGGGGG - Intergenic
1180981376 22:19879610-19879632 CAGGGTGGTGGGGGGGGTGGGGG + Intronic
1181227854 22:21402893-21402915 CAGGTTGGGGGCAGAGCTGGGGG + Intergenic
1181250798 22:21531946-21531968 CAGGTTGGGGGCAGAGCTGGGGG - Intergenic
1181367409 22:22388704-22388726 CAGGCTGGTGGCAGGAGTGGAGG + Intergenic
1181438406 22:22923358-22923380 CAGGCTGGGAAAAGAGATGGTGG - Intergenic
1181494488 22:23280308-23280330 CAGGCTGGTGGGAGTGAGGAGGG - Intronic
1181604226 22:23970798-23970820 CAGGCTGGGAGGACAGCTGGGGG - Intronic
1181696176 22:24593916-24593938 CAGGCTGGGGTCAGAGGTGGGGG - Intronic
1181871828 22:25905495-25905517 CAGGGTTGGGGGAGAGATCGGGG + Intronic
1181998413 22:26901490-26901512 CAGGCTGGTGGGGGACTGGGAGG + Intergenic
1182218911 22:28742409-28742431 CTGGCTGGCGGAAGAGAAGGCGG + Intronic
1182451616 22:30425206-30425228 CAGGCTGGTGGGAGGGTTTCAGG + Exonic
1182567908 22:31213257-31213279 CAGGGTGGTGTGTGAGGTGGCGG - Intronic
1183119468 22:35719369-35719391 AAGGCTCGTGGGCGGGATGGTGG - Intronic
1183121214 22:35731571-35731593 GAGGCTGGAGAGAGAGCTGGAGG + Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183667182 22:39252898-39252920 CACACTGGTGGGTGGGATGGGGG - Intergenic
1183863382 22:40685096-40685118 CAGGCTGGGGAGAGATGTGGTGG - Intergenic
1184205313 22:42998778-42998800 CAGGATGATGGGGGACATGGTGG - Intronic
1184358304 22:43997142-43997164 GAGGCAAGAGGGAGAGATGGGGG - Intronic
1184370412 22:44078397-44078419 CAGGATGGTGGCAGAGAAGAGGG - Intronic
1185050911 22:48553515-48553537 CAGGATGGTGGGAGAGGGTGAGG + Intronic
1185211027 22:49570580-49570602 GAGGCTGGTGGGGGGGGTGGTGG - Intronic
1185288740 22:50013844-50013866 CGGGGTGGTGGGAGGGAGGGAGG - Intergenic
1185352949 22:50347483-50347505 CAGGCTGAAGGAAGAGATGATGG - Intronic
1185362155 22:50414784-50414806 CACGCTAGGTGGAGAGATGGGGG - Intronic
949190498 3:1243919-1243941 CAGGCGGGAGGGAAAGAAGGAGG + Intronic
949726126 3:7047451-7047473 CCCACTGGTGAGAGAGATGGTGG - Intronic
949898017 3:8784684-8784706 CAGGCAGGTGGGAGAGGGGGTGG + Intronic
950085027 3:10251197-10251219 CAGTCTGGTGGGAGGGCTGGAGG + Intronic
950271154 3:11616204-11616226 CAGGCAGGTGGGAGGGGAGGTGG - Intronic
950332582 3:12168271-12168293 ATGGGAGGTGGGAGAGATGGAGG + Intronic
950552575 3:13675573-13675595 GAGGCTGCTGGCAGAGCTGGAGG - Intergenic
951558657 3:23945388-23945410 CAGGCTGCAGCGAGAGAGGGTGG - Exonic
951762911 3:26164536-26164558 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
952296708 3:32068778-32068800 CAGGCAGGAGGGAAAGAAGGAGG - Intronic
952819187 3:37471251-37471273 CATGCTTGTTGGAGAGAAGGAGG - Intronic
953381514 3:42476200-42476222 CAGGCTGTGGGGAGACTTGGAGG + Intergenic
953557185 3:43955598-43955620 CAGGATGGAGGGATGGATGGAGG + Intergenic
954264442 3:49461664-49461686 CAGAGTGGAGGCAGAGATGGGGG - Intergenic
954443421 3:50534096-50534118 CAGGCTGGGGAGAGAGACCGGGG - Intergenic
954538772 3:51380307-51380329 CAGGCTGGGGAGAGAGGTGAAGG - Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
955067997 3:55548854-55548876 TTGGCTGGAGGGAGAGGTGGTGG - Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955754824 3:62216539-62216561 CTGGCTGGTGGGGGAGGGGGGGG - Intronic
955809967 3:62777375-62777397 CAGGCTGCTGGGGGATGTGGAGG + Intronic
956233614 3:67042871-67042893 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
956681626 3:71786198-71786220 CAGGCTAGGATGAGAGATGGAGG - Intergenic
957672608 3:83324583-83324605 CATGCTGCTGGGATGGATGGGGG + Intergenic
958560773 3:95744848-95744870 CAGGCGGCTGGGGGAGGTGGGGG - Intergenic
958750891 3:98192516-98192538 CAGGCGGGAGGGAAAGAAGGAGG - Intronic
959308872 3:104704928-104704950 CAAGCTGTTTGAAGAGATGGTGG - Intergenic
959383990 3:105678526-105678548 GGGGGAGGTGGGAGAGATGGAGG + Exonic
959482000 3:106885120-106885142 CAGGCTGGTGGCATTGATTGTGG + Intergenic
960079870 3:113530046-113530068 AAGGGTAGTGGGAGAGCTGGGGG + Intergenic
960284227 3:115809414-115809436 CAAGTTGCTGGGGGAGATGGCGG - Exonic
961147141 3:124603656-124603678 CATGCTCGTGGGAGAGTTGTGGG - Intronic
961452163 3:127007136-127007158 CAGGGTGGTGGGGGAGCTGGCGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
962329119 3:134462078-134462100 AAGGAGGGAGGGAGAGATGGGGG - Intergenic
962826384 3:139103770-139103792 CAGGCTGGTGCCAGAGATCAGGG - Intronic
962894728 3:139704144-139704166 CAGGCAGGTGGGTAAGGTGGGGG + Intergenic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
963160658 3:142148571-142148593 CAGGCTGGTAAGAGAGACTGGGG + Intronic
963712676 3:148765331-148765353 CAAGCTGGTGCGGGAGATGTGGG - Intergenic
964125569 3:153230865-153230887 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
964147243 3:153479755-153479777 CAGGGTGGTAGCAGTGATGGTGG + Intergenic
964463156 3:156959538-156959560 CAGAGTGGTGGGATAGAAGGTGG - Intronic
964555830 3:157936939-157936961 CAATCTGGTGGGAGAGCTGGAGG - Intergenic
964984981 3:162726673-162726695 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
965600913 3:170453993-170454015 CACTCTGAGGGGAGAGATGGCGG - Intronic
965874388 3:173299461-173299483 GAGGCTGTTGTGGGAGATGGGGG + Intergenic
967234145 3:187367951-187367973 CAGCCTGCTGGGAGATGTGGAGG - Intergenic
967387434 3:188925600-188925622 CGGGCTGGTGGAGAAGATGGCGG + Intergenic
967876315 3:194270614-194270636 CAGGCTTGTGTGAGGGGTGGAGG - Intergenic
968142386 3:196269073-196269095 CAGGGTGTTGGCAGAGCTGGAGG - Intronic
968647178 4:1746785-1746807 CAGGCTCGGGGCTGAGATGGGGG - Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969056998 4:4408289-4408311 CAGGCTGCTGGGAGGGGCGGTGG + Intronic
969229002 4:5816708-5816730 CATGATGGAGGGAGAGAGGGAGG - Intronic
969366449 4:6697493-6697515 CATGCTGTTTGGAGAGATGGAGG - Intergenic
969376399 4:6766308-6766330 CAGGCTGCTGGGAACGAGGGTGG - Intergenic
969569902 4:8002158-8002180 CAGGCTGGAGGCAGAGACTGAGG - Intronic
969599961 4:8170507-8170529 GTGGCTGGTGGAGGAGATGGTGG + Intergenic
969705421 4:8788919-8788941 CCGGGAGGAGGGAGAGATGGAGG + Intergenic
969705447 4:8789012-8789034 CCGGGAGGAGGGAGAGATGGAGG + Intergenic
969705552 4:8789353-8789375 CTGGGAGGAGGGAGAGATGGAGG + Intergenic
969705561 4:8789384-8789406 CTGGGAGGAGGGAGAGATGGAGG + Intergenic
969705580 4:8789446-8789468 CTGGGAGGAGGGAGAGATGGAGG + Intergenic
970138878 4:12958111-12958133 CAGAGTGGTGGGAGAGAGTGAGG - Intergenic
970172752 4:13305740-13305762 CAGGCGGATGGGAGTGATGGTGG - Intergenic
970625717 4:17877542-17877564 TCTGCTGGTGTGAGAGATGGAGG + Intronic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
971712218 4:30129178-30129200 CAGGAGGGAGGGAGAGAGGGTGG - Intergenic
972568492 4:40289687-40289709 CAGGCTGGTGGCAGTGGAGGTGG + Intergenic
973150719 4:46884253-46884275 CAGGCTGCAGGGAGCTATGGTGG - Intronic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
975376725 4:73654694-73654716 CAGAGTGGTGGGATAGATTGAGG + Intergenic
976005986 4:80431356-80431378 AAGGAAGGGGGGAGAGATGGAGG - Intronic
977041911 4:92027411-92027433 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
977317443 4:95468030-95468052 AAGGGTGGTGGCAGAGGTGGAGG + Intronic
977669574 4:99680325-99680347 CATGCTGGTGGGAGAGATGTGGG + Intergenic
978083609 4:104623157-104623179 AAGCATGGTGGAAGAGATGGAGG + Intergenic
978698563 4:111614887-111614909 CATGATGGTGGCTGAGATGGTGG - Intergenic
980135759 4:128857229-128857251 CTGTCTGGTAGGAGAGATGTAGG + Intronic
980264624 4:130499362-130499384 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
981528321 4:145729747-145729769 CATGCTGGTGGCAGAGGAGGGGG + Intronic
981700924 4:147606426-147606448 AAGGCAGGTGGGAGAGGAGGAGG + Intergenic
981849135 4:149207586-149207608 CAGTCTAGAGGTAGAGATGGAGG - Intergenic
982357768 4:154489412-154489434 CAGGCAGGTGGCAGAGAGTGGGG + Intronic
982474877 4:155837919-155837941 GAGGCTGGAGGGAGAGCTTGGGG - Intronic
983355858 4:166656503-166656525 CAGCCATGTGGCAGAGATGGAGG + Intergenic
983846877 4:172531684-172531706 CTGGCTGAGGGGAGAGAGGGTGG + Intronic
983940887 4:173533061-173533083 CATCCTGGTGGTAGTGATGGAGG + Intergenic
985140861 4:186839915-186839937 CAGAGAGGTGGGAGAGAGGGAGG + Intergenic
985582249 5:704356-704378 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
986097533 5:4574469-4574491 CATGGTGGTGGGAGTGGTGGTGG - Intergenic
987035587 5:14015157-14015179 CTGGCTGGTGGGGAAGATGCTGG + Intergenic
988216502 5:28281273-28281295 CAGGCTGGCGAAGGAGATGGAGG - Intergenic
988696355 5:33626254-33626276 CAGGATGGTGGTAGTGGTGGGGG + Intronic
989117352 5:37968154-37968176 AAGGCTGGTGGTAGAAAAGGTGG + Intergenic
989125262 5:38046691-38046713 CAGGCTGGCTGGTGAGAGGGTGG + Intergenic
989459857 5:41684829-41684851 CAGGGTGGTGGGAGAGGGGTTGG - Intergenic
990358162 5:54990929-54990951 CAGGCTGCTAGGAGGGGTGGTGG - Intronic
993579089 5:89636849-89636871 GAGGCTGGGGTAAGAGATGGGGG + Intergenic
994145391 5:96389085-96389107 CAGTGGGGTGGGAGAGGTGGGGG + Intergenic
994149509 5:96432254-96432276 GAAGCTGGGGGGAGAAATGGTGG - Intronic
994253618 5:97566610-97566632 CAGGCTAGAGAAAGAGATGGAGG - Intergenic
995471026 5:112502345-112502367 CAAATTGGTGGGAGAGATGGGGG - Intergenic
995562258 5:113395604-113395626 CAGCCTGGGGGGAAAGAGGGAGG - Intronic
995819915 5:116218293-116218315 CATGGTGGTGGCAGTGATGGTGG + Intronic
995999200 5:118338368-118338390 CAGGAGGGTGGGAGAGTAGGAGG + Intergenic
996358743 5:122623041-122623063 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
996729253 5:126701475-126701497 CAGGCTGGTGGTGGTGGTGGTGG + Intergenic
997603888 5:135159147-135159169 CAGTCTGGAGGTAGAGATAGAGG - Intronic
997987788 5:138517470-138517492 CAGGTAAGTGGGAGGGATGGGGG + Intronic
998092065 5:139377229-139377251 CTGGCTGGAGGGAGAGAATGAGG - Intronic
998169563 5:139864563-139864585 CAGGATGGTGGGAGAGGGGGCGG - Intronic
999763700 5:154722384-154722406 CAGGCTGGTGGGTGGGCAGGAGG + Intronic
1000225197 5:159254703-159254725 CAGGCTTGGGGTAGGGATGGGGG - Intergenic
1000618413 5:163455861-163455883 CAGAATGGTGGTAGAGTTGGTGG + Intronic
1000996095 5:167960536-167960558 CAGCTTGGTGGGAGGGAGGGGGG - Intronic
1001021560 5:168187291-168187313 CAGGCTGGAGGGGGAGGGGGAGG + Intronic
1001214724 5:169845181-169845203 CAGGCAGGTGACAGAGAGGGAGG - Intronic
1001776296 5:174331545-174331567 CAGGCGGGTGGGAGAGTGGATGG - Intergenic
1001944877 5:175770630-175770652 CACGCTGGTGGGAGATAACGAGG - Intergenic
1002105733 5:176878730-176878752 CAGGCGGGAGGGAGAGTGGGTGG - Intronic
1002200191 5:177523799-177523821 CAGGCTGGTGGGAGAGGGCCTGG + Intronic
1002275413 5:178101369-178101391 TAGGCTGGAGGGAAAGAGGGAGG - Intergenic
1002449450 5:179310557-179310579 CCGGCTGGGGTGAGGGATGGTGG + Intronic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002633979 5:180598171-180598193 CAGGCAGGGGTGAGAGTTGGGGG + Intergenic
1003065941 6:2903485-2903507 CAGGCTGGCGGGAGCATTGGCGG - Intergenic
1003086243 6:3063743-3063765 CAGGCTGGCGGGAGCATTGGCGG + Intergenic
1003200901 6:3959539-3959561 GAGGCTGGTGGGGGAGGCGGAGG + Intergenic
1003250075 6:4420079-4420101 CAGGCTGGCAGGAGGGGTGGTGG + Intergenic
1003332449 6:5141174-5141196 AATGCAGATGGGAGAGATGGGGG + Intronic
1003451941 6:6243178-6243200 GATGGTGGTGGGAGTGATGGTGG - Intronic
1004827292 6:19436925-19436947 CATCCTTGTGTGAGAGATGGTGG + Intergenic
1005816274 6:29555069-29555091 AAGGCAGGTAGGAGAGAGGGTGG + Intergenic
1006374159 6:33662725-33662747 CAGGATGGTGGGGAAGAGGGAGG - Intronic
1006621759 6:35370208-35370230 CTGGCTGTTGGGAAAGATGGTGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006781952 6:36637891-36637913 GAGGCTGGTAGAAGAGATGGTGG - Intergenic
1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG + Intergenic
1007196165 6:40062610-40062632 AAGGATGGTGGGATGGATGGTGG - Intergenic
1007329926 6:41098357-41098379 CAGCCTAGTGGGAGAGAGTGGGG + Exonic
1007387358 6:41528830-41528852 CAGCCTGGTGAGAGGGATGCGGG + Intergenic
1007410165 6:41656867-41656889 CCTGCTTGTGGGAGAGAAGGTGG + Intergenic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007661589 6:43490086-43490108 CAGGCTGCGGGGAAGGATGGAGG - Intronic
1007878259 6:45131832-45131854 CAGGCTGGTTGGAACAATGGTGG + Intronic
1007920516 6:45605393-45605415 TCGGCTGGTGGGGGAGGTGGAGG - Intronic
1008907953 6:56700226-56700248 CTGGCTGGTGGGAGGAGTGGGGG - Intronic
1009706167 6:67255230-67255252 CATGCTGGTAGAGGAGATGGGGG - Intergenic
1009959804 6:70504874-70504896 GAGGCAGGTGGTAGAGGTGGAGG + Intronic
1010133427 6:72522729-72522751 CAGGCTTTTGGCAGAAATGGTGG - Intergenic
1010289173 6:74115576-74115598 AGGGCTGGTGGGAGGGGTGGAGG + Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1012477624 6:99632069-99632091 CTGGCTGGTTGGGGAGATAGAGG + Intergenic
1013224971 6:108114180-108114202 CTGGCTGGTGGGACAGCTGGAGG - Intronic
1013493437 6:110673586-110673608 CAGGCTGGTGGAACAGCTGGTGG + Intronic
1013616633 6:111849566-111849588 CAGGCTGGAGGGAGAAAGGTGGG + Intronic
1013671120 6:112404358-112404380 ACAGCTTGTGGGAGAGATGGAGG - Intergenic
1013808250 6:114016847-114016869 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1014395901 6:120926406-120926428 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1014691091 6:124564486-124564508 CTGGCTGGTGGGGGAGGGGGGGG - Intronic
1016573411 6:145540082-145540104 CAGGCTGGAGGCAGACACGGCGG - Intronic
1017451138 6:154555478-154555500 AAGGCTGGTGGGTGGGGTGGGGG + Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017882135 6:158569344-158569366 CAGGCTCGTGGGTGAGAGGGTGG - Intronic
1018273570 6:162106204-162106226 CAGGCTGGGAGAAGAGATGTGGG + Intronic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1018870435 6:167778499-167778521 CAGGCAGGTGGGGGTGAAGGTGG - Intergenic
1018974234 6:168552821-168552843 CAGGCTGGTGGGGGGGTGGGGGG - Intronic
1019215173 6:170438785-170438807 CAGGCTGGGGGGTGGGCTGGAGG + Intergenic
1019601449 7:1885797-1885819 CAGGCTGGAGGGAGAGAGACAGG - Intronic
1019779221 7:2929804-2929826 CACTCTGGAGGGAGAGAGGGTGG + Intronic
1019805118 7:3117917-3117939 CAGGAGGGTGGGAGAGAAGGTGG - Intergenic
1020106046 7:5422774-5422796 GAGCCTGATGGGAGAGAGGGAGG - Intronic
1020430679 7:8113508-8113530 GAGGCTGGGGGCAGAGAAGGAGG + Exonic
1020637476 7:10714163-10714185 CAGGCAGGTAGCAGAGCTGGGGG + Intergenic
1020874833 7:13679395-13679417 CAGCCTGGAGGGTGGGATGGGGG + Intergenic
1020974262 7:14985775-14985797 CAGGCTGGGAGGACAGATGCAGG - Intergenic
1021172553 7:17415334-17415356 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1021393506 7:20122142-20122164 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1022009402 7:26295683-26295705 CAGCTTGGTGAGAGAGCTGGGGG - Intronic
1022414036 7:30162889-30162911 GAGGCTGGGGGAAGAGAGGGAGG + Intergenic
1022667087 7:32421602-32421624 CAGCCTGGTGTCAGAGAAGGAGG - Intergenic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1023686343 7:42739330-42739352 CTGGCTGGTGAGAGAGATGACGG - Intergenic
1023744394 7:43309290-43309312 CAGGGTGGTGGGAGAGGGTGGGG + Intronic
1023956859 7:44893508-44893530 CAGGCTGGCAGGAGAGCTTGGGG + Intergenic
1023966645 7:44966310-44966332 CAGGCCTGGGGGAGAGATGATGG + Intronic
1024325757 7:48108002-48108024 CAGGGTGGTGTCAGAGAGGGAGG + Intronic
1024350693 7:48359660-48359682 CGGGCTGATGTGAGAGGTGGTGG + Intronic
1024983947 7:55180050-55180072 CAGGCTGGCGGGAGGCAGGGTGG - Intronic
1025227671 7:57178654-57178676 AAGGCTGGTTGGGGGGATGGGGG + Intergenic
1025255615 7:57382170-57382192 AAGGCTGTTGGGGGACATGGGGG + Intergenic
1025711587 7:63915288-63915310 CTGGTGGGTGGGAGAAATGGGGG + Intergenic
1025778883 7:64582027-64582049 CAGACTGGTGGGAGGGATCTAGG + Intergenic
1025929106 7:65980736-65980758 AAGGCTGGTTGGAGGAATGGGGG + Intronic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026217208 7:68360245-68360267 CAGCCTGGTGACAGAGAGGGGGG - Intergenic
1026571931 7:71538859-71538881 AGGGATGGTGGGAGAGAGGGAGG + Intronic
1026659384 7:72286271-72286293 CACAGTGGTGGAAGAGATGGTGG - Intronic
1026809065 7:73447058-73447080 CTGCCTGGTGGGAGAGAAGGTGG - Intronic
1026937827 7:74269132-74269154 CAGGCTGTGGGGTGAGAGGGTGG + Intergenic
1028064484 7:86365446-86365468 CAGGAAGCTGAGAGAGATGGTGG + Intergenic
1028160595 7:87480382-87480404 CATGATGGTGGTAGAGCTGGAGG - Intronic
1029500101 7:100923703-100923725 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1029628292 7:101734119-101734141 CAGGCAGATGGGTGAGAAGGGGG - Intergenic
1029792915 7:102864161-102864183 GAGGCTGGAGAAAGAGATGGAGG - Intronic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1031888136 7:127262031-127262053 CAGGCTGGTGGGAACGCTAGGGG + Intergenic
1032473336 7:132194160-132194182 CAGGATCGTGTGTGAGATGGGGG - Exonic
1032529391 7:132607847-132607869 GAGGATGATGGGAGTGATGGTGG - Intronic
1032836935 7:135683338-135683360 CAGGCTGGTGGCAGATATTCAGG - Intronic
1032861830 7:135887234-135887256 GAGGCAGGAGGGAGAGAAGGGGG + Intergenic
1033128837 7:138728298-138728320 CAGGGTGGTGGGGGAGATTGCGG - Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033308152 7:140239759-140239781 TAGGCTGGAGGGAGAGAAGGAGG + Intergenic
1034074999 7:148222823-148222845 CAAGCTCATGGGTGAGATGGTGG + Intronic
1034204284 7:149302314-149302336 CAGGATGGTAGCAGAGGTGGCGG - Intergenic
1034950247 7:155291900-155291922 GAAGTAGGTGGGAGAGATGGGGG - Intergenic
1034954742 7:155327566-155327588 CAGGGTTGGGGGAGAGAGGGGGG - Intergenic
1035032367 7:155869899-155869921 CAGGCTCGTGGCAGGGATGGAGG + Intergenic
1035363314 7:158328629-158328651 CTGGGTGGTGGGAGGAATGGGGG - Intronic
1035459605 7:159030868-159030890 CAGGCGGGAGGGAGAGCTGGAGG - Intronic
1035609084 8:948457-948479 TGGTGTGGTGGGAGAGATGGAGG - Intergenic
1035625744 8:1069239-1069261 CAGGGAAGTGGGAGAGGTGGTGG + Intergenic
1036920620 8:12851018-12851040 CAGGCTGGGGGAAAAGACGGAGG - Intergenic
1036962624 8:13261625-13261647 CAGGGTGGTGGCAGTGAGGGTGG + Intronic
1037399199 8:18476641-18476663 CCAGCTGGTGGCAGAGATGGTGG - Intergenic
1037451566 8:19020686-19020708 CAGGGTGGTGGCAAAGAAGGAGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1037905669 8:22714731-22714753 CAGGCAGGTGGGAGGGTGGGTGG - Intronic
1038022255 8:23560541-23560563 CAGGCAGGTGGAAGAAATGATGG + Intronic
1038052621 8:23827824-23827846 CTGGCTGGGAGGAGAGATGGAGG + Intergenic
1038409422 8:27346577-27346599 CATGCTGCTGTGAGTGATGGAGG + Intronic
1038643888 8:29348276-29348298 GGCGCTGGTGGGAGAGATGAGGG - Intronic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1039469027 8:37802330-37802352 AAAGCTGGTGGAAGAGAAGGGGG - Intronic
1039472300 8:37821063-37821085 GAGGGTGGTGGGAGAGAGAGAGG - Intronic
1039826311 8:41176831-41176853 GAGGCTGGTGTGTGAGGTGGTGG - Intergenic
1040036489 8:42875202-42875224 CAGGCTGGTAGGTGGGGTGGGGG + Intronic
1040500052 8:47997790-47997812 CGGGATGGTTGGAGAGACGGAGG + Intergenic
1040551230 8:48439085-48439107 CCGGCAGGTGGGACAGATGCAGG + Intergenic
1040558331 8:48500739-48500761 CAGGATGGTTAGAGAGATGGGGG + Intergenic
1040857242 8:51960885-51960907 GAGGATGGTGGGAAAGATTGGGG + Intergenic
1040906491 8:52474520-52474542 CAGGCTGCTGTTAAAGATGGGGG - Intergenic
1041407835 8:57519763-57519785 GGGGCTGGTTGGAGAGATGTTGG - Intergenic
1041929054 8:63267285-63267307 CAATCTGGTGGGAGGGAAGGGGG + Intergenic
1042369196 8:67971385-67971407 CAGGGTGCGGGGAGAGAGGGTGG + Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1043598730 8:81914964-81914986 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1044228823 8:89750638-89750660 AAGGATGGTGGGAGAGTTAGGGG + Intergenic
1044663729 8:94615422-94615444 CAGGCTGGTGGTGTCGATGGGGG + Intergenic
1044961714 8:97537806-97537828 CAGGCTGATGGGACTGATTGTGG - Intergenic
1044966602 8:97579873-97579895 CAGGCAGCTGGGAGAAGTGGAGG + Intergenic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1046015707 8:108602710-108602732 AAGGATGGAGGGAGAGAGGGAGG - Intergenic
1047037623 8:120956724-120956746 CAGAGTGGTGGGAGAGAGGCAGG + Intergenic
1047309442 8:123679400-123679422 CATGGTGGCAGGAGAGATGGGGG - Intergenic
1047355661 8:124119330-124119352 CTGGCAGGTTGGACAGATGGAGG + Intronic
1047636507 8:126768798-126768820 GAGGCTGGGGAGGGAGATGGAGG + Intergenic
1047917367 8:129596305-129596327 GAGGCAGGAGAGAGAGATGGGGG - Intergenic
1047927636 8:129696992-129697014 GAGGGAGGTGGGAGAGAGGGAGG + Intergenic
1047953669 8:129956820-129956842 GAGGCTGGGGGGAGGGAGGGAGG - Intronic
1048097503 8:131311753-131311775 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1048210367 8:132449738-132449760 CTGCTTGGTGGGAGAGCTGGGGG + Intronic
1048249896 8:132855403-132855425 AAGGAAGGTGGGAGAGAGGGAGG - Intergenic
1048417382 8:134242590-134242612 CATGGAGGTGGGAGAGATTGTGG + Intergenic
1048547542 8:135401657-135401679 GAGGCTGGGGGTAGGGATGGGGG + Intergenic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1049249177 8:141578999-141579021 CAGGAGGGTGGGAGTGAGGGAGG + Intergenic
1049320172 8:141992079-141992101 CTGGCTGCTGGGAGAGTGGGTGG - Intergenic
1049328509 8:142037572-142037594 CAGGCTGGTGGGCCAGATTGGGG - Intergenic
1049406802 8:142455236-142455258 GAGGCGAGTGGGAGTGATGGGGG - Intronic
1049746555 8:144265610-144265632 CAGGCTGGAAGGAGCGAGGGTGG - Intronic
1049833970 8:144721170-144721192 GGGGTTGGTGGGAGAGGTGGTGG + Exonic
1050731404 9:8713688-8713710 CATGATGGTGGAAGAGATCGCGG + Intronic
1051052511 9:12949886-12949908 CAGGCGGGAGGGAAAGAAGGAGG - Intergenic
1051366715 9:16326576-16326598 AGGGCAGGTGGGAGAGGTGGGGG - Intergenic
1051912856 9:22174310-22174332 CAAGTTGGTGGAAGAGATGTAGG - Intergenic
1052230536 9:26145643-26145665 CAGGCTTGGAGGAGAGAAGGTGG + Intergenic
1052861244 9:33439185-33439207 AAGGCTCTTGGGAGAGATGGAGG - Intergenic
1053145519 9:35709380-35709402 CAGGGAGGTGGTGGAGATGGAGG + Intronic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1055673663 9:78632843-78632865 CAGGCTGTTGGGTGAGAAGGAGG - Intergenic
1055765833 9:79662926-79662948 CAGGCTTGTGGGGGCGAGGGAGG - Intronic
1056190013 9:84175854-84175876 CAAGCTGGGGGGAGGGAAGGTGG - Intergenic
1056409915 9:86314960-86314982 GAGGTTGATGGAAGAGATGGAGG - Intronic
1056520904 9:87400631-87400653 TAGGCTGGTGGGGCAGTTGGGGG + Intergenic
1056705924 9:88952780-88952802 CACCCTGGTGGGAGAGCTGAGGG - Intergenic
1057283933 9:93732689-93732711 CAGGGGGGAGGGAGAGAGGGAGG + Intergenic
1057432118 9:95004626-95004648 CAGGCTGGAGGGAGCGGTGGCGG - Intronic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057701347 9:97365310-97365332 CAGTCTGCTGGGAGAGATGGAGG + Intronic
1057810548 9:98253833-98253855 AAGTCTGGTGGGAGAGACTGAGG - Intronic
1057812694 9:98269990-98270012 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1057851568 9:98570629-98570651 CAGGCTGGTGGGAGATCTGCAGG + Intronic
1058012976 9:99998886-99998908 GAGACTGCTGGGGGAGATGGAGG - Intronic
1058837295 9:108869445-108869467 CAAACTGGTGGGAGGGGTGGTGG + Intronic
1058938568 9:109791955-109791977 CAGGCTGGGGGTAGAGGGGGAGG - Intronic
1060180262 9:121528845-121528867 CAGTCTGGAGGGGGAGATAGAGG + Intergenic
1060301464 9:122376820-122376842 CAGGGTGGTGGGGGTGATGGTGG + Intronic
1060483585 9:124032565-124032587 CAGGGTGGTGGGCGTGCTGGAGG - Exonic
1060585318 9:124782015-124782037 AAGGCTGCAGGGAGAGATGCAGG + Intronic
1060847533 9:126849206-126849228 CAGGCTGGTGGAGGAGCTGCAGG - Intergenic
1060883289 9:127133561-127133583 CAGGCCGGTGGGTGAGTGGGTGG - Intronic
1061316068 9:129796509-129796531 GAGGCTGGTGGCAGGGAGGGAGG + Intergenic
1061371012 9:130197600-130197622 CTGGCTGGCGGGAGGGCTGGGGG + Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1061905744 9:133696008-133696030 AAGGCAGGAGGGAGAGGTGGAGG + Intronic
1062289210 9:135787058-135787080 CTGGCTGCTGGGAGGGCTGGGGG - Intronic
1062405124 9:136392591-136392613 CTGGCTGGTGGAAGGGATGAGGG + Exonic
1062576745 9:137212394-137212416 CAGGCAGGTGGGTAGGATGGGGG - Intronic
1203761181 EBV:13499-13521 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203762110 EBV:16571-16593 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203763039 EBV:19643-19665 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203763968 EBV:22715-22737 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203764897 EBV:25787-25809 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203765826 EBV:28859-28881 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203766755 EBV:31931-31953 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203767684 EBV:35003-35025 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203773769 EBV:61874-61896 CGGGATGGCGGCAGAGATGGAGG - Intergenic
1203745532 Un_GL000218v1:39041-39063 CAAGCTGGTGAGTGAGGTGGAGG - Intergenic
1203564577 Un_KI270744v1:80443-80465 CAAGCTGGTGAGTGAGGTGGAGG + Intergenic
1185642464 X:1596445-1596467 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642479 X:1596492-1596514 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642493 X:1596539-1596561 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642508 X:1596586-1596608 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642523 X:1596633-1596655 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642538 X:1596680-1596702 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1186568819 X:10692991-10693013 CAGGCTAGAGGAAGAGTTGGTGG - Intronic
1186581784 X:10827451-10827473 CTGGCTGGTGGGCGGGGTGGGGG - Intronic
1186874282 X:13801763-13801785 CAGGCTGGTAGGAGAGGTAATGG - Intronic
1189255040 X:39631397-39631419 CAGGCTGCTGGACCAGATGGGGG - Intergenic
1189322319 X:40094478-40094500 CGGGCTGGTGGGAGCGCGGGGGG - Intronic
1189386907 X:40544705-40544727 GAGGCAGGTAGGAGAGAAGGGGG - Intergenic
1189738716 X:44097132-44097154 CAGGCTGGAGTGAGACATGCCGG - Intergenic
1190109724 X:47582258-47582280 GAGGCGGGTGGGAGAGGAGGAGG + Intronic
1190247392 X:48699666-48699688 CAGGGTGGTGGCAGTGATGATGG + Intronic
1190295991 X:49028028-49028050 CAGTCTGGTGGGGGAAATGGAGG + Intergenic
1192173089 X:68868711-68868733 CAGGGTGGTGGAAGAGGAGGTGG + Intergenic
1192584207 X:72306979-72307001 CTGGCTCGTGGGCGAGTTGGTGG + Intronic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1194873912 X:99163576-99163598 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1195908038 X:109864798-109864820 CAGGAAGGAGGGAGAGAGGGAGG - Intergenic
1195968221 X:110448486-110448508 TAGGCTGGTGGGACTGTTGGGGG + Intronic
1196107265 X:111910392-111910414 CAGGGCTGTGGGAGAGAGGGAGG + Intronic
1196189802 X:112782414-112782436 CAGGCTGGCAGGGGTGATGGTGG + Intronic
1196221089 X:113112854-113112876 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
1196542352 X:116924503-116924525 CAGGCAAGTGGTAGTGATGGAGG + Intergenic
1196595947 X:117545662-117545684 CAGACTTGTGGGAGAGCAGGTGG - Intergenic
1196704905 X:118708617-118708639 CAGGCTTGTGGGGTAGATTGAGG - Intergenic
1196992806 X:121347159-121347181 CAGGCGGGAGGGAAAGAAGGAGG + Intergenic
1197499608 X:127228125-127228147 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1197633195 X:128885723-128885745 CAGGGTGGTGGGAGAGGGGTAGG + Intergenic
1198130006 X:133684320-133684342 AAGGCTGGTGGGAGGGACAGAGG - Intronic
1198487408 X:137101983-137102005 CAAGCTGGTGGGAAAGAGGCAGG + Intergenic
1198846209 X:140914504-140914526 CATGCTGCTGGGAGAGAAAGAGG + Intergenic
1199685435 X:150261024-150261046 CAGGCTGATGCCTGAGATGGTGG + Intergenic
1199748446 X:150791674-150791696 CAGTCTGTTGGCAGAAATGGGGG + Intronic
1200122860 X:153799381-153799403 CAGGCTGATGGGAGAGGTGCAGG - Intergenic
1200229261 X:154436062-154436084 CACCTTGTTGGGAGAGATGGGGG - Exonic
1201158853 Y:11154052-11154074 CAAGCTGGTGAGTGAGTTGGAGG - Intergenic
1201334888 Y:12869961-12869983 GAGGCAGGAGGGAGAGAAGGAGG - Intergenic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1201977469 Y:19868536-19868558 CAGGCTGGTGGGAAACATTATGG + Intergenic
1202076670 Y:21043598-21043620 CAGGTGGGTGGGAAAGAAGGAGG + Intergenic
1202367802 Y:24178858-24178880 CAGAAGGGTGGGAGGGATGGCGG + Intergenic
1202502981 Y:25491265-25491287 CAGAAGGGTGGGAGGGATGGCGG - Intergenic