ID: 1033246081

View in Genome Browser
Species Human (GRCh38)
Location 7:139717338-139717360
Sequence AAGCAACCCAGGGAGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033246081_1033246084 -7 Left 1033246081 7:139717338-139717360 CCTCAGTTCTCCCTGGGTTGCTT 0: 1
1: 0
2: 1
3: 46
4: 273
Right 1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG 0: 1
1: 0
2: 0
3: 7
4: 123
1033246081_1033246085 -4 Left 1033246081 7:139717338-139717360 CCTCAGTTCTCCCTGGGTTGCTT 0: 1
1: 0
2: 1
3: 46
4: 273
Right 1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033246081 Original CRISPR AAGCAACCCAGGGAGAACTG AGG (reversed) Intronic
901615085 1:10532590-10532612 CAGCAAGCCAGGGAGAATTCTGG - Intronic
902149962 1:14435176-14435198 AAGGAAAGCAGGGAGAACAGTGG - Intergenic
902576789 1:17383125-17383147 ACGCAACGCAGGGAGCTCTGTGG + Intronic
903747170 1:25595448-25595470 AAGCAACTCAGGTAGGACTGAGG - Intergenic
905704122 1:40041236-40041258 GAGCAACACGGGAAGAACTGGGG - Intronic
906812463 1:48842439-48842461 AAGCATCCACAGGAGAACTGGGG - Intronic
907635012 1:56125403-56125425 AAGGACCCCAGGGAGCTCTGGGG + Intergenic
908473007 1:64462707-64462729 AAGAAACCCATAGAGAATTGTGG - Intergenic
909200161 1:72681387-72681409 AAGCAACATAGGTAGAACTGGGG - Intergenic
909314503 1:74198319-74198341 AAGCCACCCAGCGAAAATTGCGG + Exonic
910723207 1:90310480-90310502 AAGGAACACAGGGATAACTGCGG - Intergenic
912693673 1:111823776-111823798 TAGCAGCCCAGGCAGAACTGAGG + Intronic
913262302 1:117010481-117010503 TAGCAACCTATGGAGAGCTGCGG - Intronic
914250026 1:145914407-145914429 AAGAAAACCATGGAGAGCTGTGG - Intronic
914334243 1:146700539-146700561 GAGCTACCCAGGGACAGCTGTGG - Intergenic
914945193 1:152059351-152059373 AAGAAACCAAGAGAGATCTGAGG - Intergenic
915662896 1:157418391-157418413 GACCAACCCAGGGCAAACTGTGG - Intergenic
916162534 1:161932899-161932921 AAGGAACTGAGGGAGAACTCTGG - Intronic
916169381 1:161989147-161989169 AAGCAGCACAGGGAATACTGGGG - Intronic
916581184 1:166110667-166110689 GAGCCACACAGGGAGACCTGAGG + Intronic
916786615 1:168091333-168091355 AAGCGACCCAGTAAAAACTGAGG + Intronic
918125509 1:181580207-181580229 AAGAAACCCAGGAAGAACTCAGG + Intronic
920055633 1:203189028-203189050 AGGCAACCCATGGAGAATTGCGG + Intergenic
922808753 1:228404218-228404240 ACACAACCCAGAGAGATCTGGGG + Intronic
923430401 1:233914343-233914365 AAGTAACCCAGAGAGAGCAGTGG + Intronic
1062964767 10:1598759-1598781 AAGCAAGCCAGGGAGAGCCCTGG + Intronic
1063046682 10:2399326-2399348 AAGCCACCCGGGGCGAACTTGGG + Intergenic
1063389757 10:5641579-5641601 AGGGAACCCAGGGAGAGCTGGGG + Intronic
1063735701 10:8751818-8751840 AAGCAACCCAGAAAGCAATGTGG + Intergenic
1063959200 10:11292864-11292886 ATGCTTCACAGGGAGAACTGAGG - Intronic
1064423744 10:15212573-15212595 CAGAATCCGAGGGAGAACTGAGG + Exonic
1064450734 10:15439975-15439997 AAGCAACCCTGGCAGAGGTGGGG + Intergenic
1064668710 10:17685772-17685794 AAAGAAAGCAGGGAGAACTGGGG + Intronic
1064852953 10:19730760-19730782 GAGCAACCCAGAGAAAACAGAGG + Exonic
1065100221 10:22324473-22324495 AAGTAATCCAGAGATAACTGAGG + Intronic
1065224642 10:23531360-23531382 AAGGCACCCAGGAAGATCTGTGG + Intergenic
1066391624 10:34981408-34981430 AAGGAACCCTGGGAGAAGAGGGG + Intergenic
1067350052 10:45467353-45467375 AAGAAAACCAGTGAGATCTGTGG + Intronic
1070387550 10:75939562-75939584 ATGCAACCCAGTGAGAACTCAGG - Intronic
1070568124 10:77619508-77619530 AAGCAACCCATGGATTACAGGGG + Intronic
1070762179 10:79030713-79030735 AAGCAACACAGAGAGAAGTCAGG - Intergenic
1071136257 10:82457856-82457878 AATCAGCCCAGGGAGAACAGAGG - Intronic
1072262714 10:93696391-93696413 AAACAACCCAGAGAAAACTGTGG + Intronic
1072624240 10:97100862-97100884 GAGCAAGCCAGGGAGCCCTGTGG - Intronic
1073065709 10:100758006-100758028 AATCAACCATGGGAGAAATGAGG + Intronic
1073246015 10:102090685-102090707 CAGCAGCCCTGGGAGATCTGGGG - Intergenic
1073550305 10:104393869-104393891 AAGCATCCCAGGGAGGAGTTTGG - Intronic
1074404800 10:113171693-113171715 AAGCAACCCAGACAGGGCTGTGG - Intergenic
1074766943 10:116706519-116706541 AGAAGACCCAGGGAGAACTGCGG - Intronic
1075092970 10:119453759-119453781 CATAAGCCCAGGGAGAACTGGGG + Intronic
1075842311 10:125515602-125515624 AAGTCACCCAGAGAGATCTGAGG + Intergenic
1076398513 10:130160345-130160367 AACCAACTCAGGGAACACTGGGG - Intronic
1077219319 11:1408400-1408422 CAGCAGCCACGGGAGAACTGGGG + Intronic
1077555621 11:3224650-3224672 AAGTAACCCGCGGAAAACTGAGG - Intergenic
1077601851 11:3580175-3580197 AAGCCACACAGGAAGAGCTGGGG + Intergenic
1078913020 11:15750935-15750957 AAGCTCCCCAGGGACAGCTGAGG + Intergenic
1079435130 11:20439445-20439467 AAATAACCCAGGGAGAGCTCTGG - Intronic
1082931971 11:58617873-58617895 GAGCAACAGAGGGAGAACAGGGG - Exonic
1085939981 11:81197356-81197378 AGGCAACACAGGGAGAAAAGCGG + Intergenic
1087173373 11:95073789-95073811 CAGCAACCTATGGAGAACAGTGG - Intergenic
1089114417 11:116082740-116082762 GAGAAACCCAGGAAGATCTGTGG - Intergenic
1090126136 11:124086693-124086715 AGGCAACCCAGGGAGAGCTGCGG + Intergenic
1090795777 11:130134722-130134744 GAGCACCCCAGGGACAGCTGGGG + Intronic
1090949916 11:131464341-131464363 CAGCAACGCAGGGAAAGCTGGGG + Intronic
1091272940 11:134330873-134330895 AAAAAACCCTGGCAGAACTGGGG - Intergenic
1091652013 12:2317879-2317901 AAGCAGCCCTGGGAGAGGTGAGG + Intronic
1094408169 12:30141110-30141132 AAGAAACACAGATAGAACTGTGG + Intergenic
1095189266 12:39237250-39237272 AAGCAACCCAGTGAAATCTCTGG - Intergenic
1097268294 12:57758525-57758547 AAGAAATCCAGGGTTAACTGTGG - Intronic
1100198704 12:92275893-92275915 AGGCCACCCAGGGAGTTCTGTGG + Intergenic
1100793476 12:98155635-98155657 ACATAACCCATGGAGAACTGGGG + Intergenic
1104512550 12:129393737-129393759 AAGCAACCCACGCCAAACTGAGG + Intronic
1105256111 13:18744913-18744935 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
1105422541 13:20265876-20265898 AAGCAACCAAAGGAAAATTGTGG - Intergenic
1105835997 13:24212456-24212478 AACCACCCCAGGGGCAACTGAGG + Intronic
1107383741 13:39885321-39885343 AACCAACCAAAAGAGAACTGAGG + Intergenic
1107733104 13:43368270-43368292 ATGCAACGCTGGCAGAACTGAGG + Intronic
1112062376 13:95754271-95754293 AAGCAACCAAGGGAAGACTTTGG - Intronic
1112761709 13:102699415-102699437 TAGCAGCCCAGGGCGAGCTGTGG - Intergenic
1112806136 13:103165732-103165754 AAGCAAGACAGGGAGAGATGAGG - Intergenic
1112964032 13:105164979-105165001 CAGCAACCCAGGGAGTATTAAGG - Intergenic
1113148803 13:107239334-107239356 CTGCAAACCAGGGAGCACTGAGG - Intronic
1115445661 14:33486465-33486487 AAGCAACCCTGGGCTAACAGGGG + Intronic
1118158379 14:63263908-63263930 GAGCTACCCAGGGTGCACTGGGG - Intronic
1121055056 14:90845566-90845588 AGGCAAACCAGGGAGACCAGAGG - Intergenic
1121222863 14:92299497-92299519 TAGCAACCCAGGAAGATCTGGGG + Intergenic
1121956557 14:98218686-98218708 AGGCAAGCAAGGGAGAACTTGGG - Intergenic
1123146821 14:106141300-106141322 CAGGAAACCAGGGAGCACTGAGG - Intergenic
1202835900 14_GL000009v2_random:77115-77137 AGGCAACCAAGGCAGAGCTGAGG - Intergenic
1124247868 15:28086019-28086041 AAGCATCCCTGTGAGGACTGGGG - Intronic
1126583896 15:50264636-50264658 AAGCAGCCCAGGGAGTACTAAGG - Intronic
1127705772 15:61545937-61545959 AAGCAAACTGGGAAGAACTGGGG + Intergenic
1131370085 15:91873358-91873380 CAGCAACCCTGGGACATCTGTGG + Intronic
1132631728 16:920936-920958 AAGCTCCCCGGGGAGAACAGCGG - Intronic
1132910704 16:2309254-2309276 AGGCAACCCAGGCAGAAGTGGGG - Intronic
1133856769 16:9556979-9557001 AAGTAAGCCAGGGAGAAGGGAGG - Intergenic
1135934617 16:26769107-26769129 AAGGGATCCAGGGAGAACAGGGG - Intergenic
1136226767 16:28865143-28865165 AAACATCACAGGGAGAGCTGGGG - Intronic
1136928544 16:34397271-34397293 AAGGAACCGAGGGGGAACTGAGG - Intergenic
1136976030 16:35014533-35014555 AAGGAACCGAGGGGGAACTGAGG + Intergenic
1137578258 16:49618035-49618057 AAGATACCCATGGAGATCTGAGG - Intronic
1138289313 16:55833214-55833236 TAGAAGCCCAGGGAGATCTGAGG - Intronic
1139336021 16:66231828-66231850 AAGCATCCCAGGCAGTTCTGGGG + Intergenic
1139361074 16:66400657-66400679 AAGCAGCCCAGGGAGCACGCAGG + Intronic
1139999375 16:71010693-71010715 GAGCTACCCAGGGACAGCTGTGG + Intronic
1142438118 16:90076118-90076140 GAGCACCCCAGGGAGGTCTGGGG + Intronic
1142649103 17:1335152-1335174 AAGCAAGCAAGGGAGCAGTGAGG - Intergenic
1143204438 17:5132368-5132390 AGGCAACCCAGGCAGAGCTGAGG - Intronic
1143798859 17:9360892-9360914 AAGTAACCCAGTGAGACCCGCGG + Intronic
1144120713 17:12150243-12150265 AAACAACCCACGAAGAACTGAGG + Intergenic
1144494429 17:15737456-15737478 AGGCAACCCAGGCAGAGCTGAGG - Intronic
1144875509 17:18395056-18395078 AGGCAACTCAGGCAGAGCTGAGG - Intergenic
1144905836 17:18639220-18639242 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1145156717 17:20549365-20549387 AGGCAACTCAGGCAGAGCTGAGG + Intergenic
1145760158 17:27421076-27421098 ATGCAGCCCAGGCAGAGCTGAGG - Intergenic
1145798895 17:27671250-27671272 AGGGAACCCAGGCAGAGCTGAGG + Intergenic
1146160180 17:30555363-30555385 AGGCAACCCAGGCAGAGCTGAGG - Intergenic
1146408251 17:32558601-32558623 AGCAAAACCAGGGAGAACTGTGG - Intronic
1146844223 17:36173453-36173475 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1146856528 17:36261388-36261410 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1146864089 17:36326987-36327009 AGGCAACCCAGGCAGAGCTGAGG - Intronic
1146872438 17:36385299-36385321 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1146879796 17:36436384-36436406 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1147066949 17:37927575-37927597 AGGCAACCCAGGCAGAGCTGAGG - Intronic
1147075322 17:37985923-37985945 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1147078481 17:38007136-38007158 AGGCAACCCAGGCAGAGCTGAGG - Intronic
1147086847 17:38065469-38065491 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1147094419 17:38131071-38131093 AGGCAACCCAGGCAGAGCTGAGG - Intergenic
1147102792 17:38189432-38189454 AGGCAACCCAGGCAGAGCTGAGG + Intergenic
1147583537 17:41639643-41639665 AAGCAGGGCAGGGAGCACTGAGG + Intergenic
1149847365 17:60015899-60015921 AGGCAACCCAGGCAGAGCTGAGG + Intergenic
1150085724 17:62272516-62272538 AGGCAACCCAGGCAGAGCTGAGG + Intronic
1151018565 17:70585428-70585450 ACACAACCCAGGGAGAAGTCTGG + Intergenic
1151197835 17:72444725-72444747 CTGCACCCCAGGCAGAACTGGGG + Intergenic
1151522647 17:74641401-74641423 AGGCAACCCAGGGTGTAGTGGGG - Intergenic
1152125037 17:78441475-78441497 AAGGCACCCAGGGTCAACTGCGG + Intronic
1152523161 17:80872370-80872392 ATGCTATCCCGGGAGAACTGCGG + Intronic
1153048417 18:877896-877918 AAGAAACCAATGGAAAACTGTGG - Intergenic
1155389693 18:25321526-25321548 AACATACCCAGTGAGAACTGTGG + Intronic
1158899611 18:61950376-61950398 AAGCAAAACAGGGAGAAACGTGG + Intergenic
1159995846 18:74963063-74963085 AAAGAAACCGGGGAGAACTGTGG - Intronic
1161728693 19:5945846-5945868 AAGCAGCCCCGGGAACACTGTGG + Intronic
1162514875 19:11141988-11142010 AAGCCGCCCAGGGAGCACTAGGG + Intronic
1163030618 19:14541750-14541772 TAGCCACCCAGAGAGACCTGTGG + Intronic
1163233993 19:16020560-16020582 AGGCAACCCAGGCAGAGCTGAGG - Intergenic
1163860983 19:19742710-19742732 AGGCAACCCAGACAGAGCTGAGG - Intergenic
1166267007 19:41690630-41690652 AACCAGCCCAAGGAGACCTGGGG - Intronic
1166339639 19:42129754-42129776 AGGCCACCCAGGGACAGCTGTGG - Intronic
1166629402 19:44391911-44391933 AAGGAACCAAGGGAGAACTTTGG - Intronic
1168290638 19:55355357-55355379 AAGCAAGCCAGAGAGAGCTTTGG + Intronic
1202636736 1_KI270706v1_random:50248-50270 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
925016113 2:525590-525612 AAGCAGCACAGGGGAAACTGAGG + Intergenic
925213115 2:2068182-2068204 AAGCCACCCAGGGAGAATGTGGG + Intronic
925328596 2:3041436-3041458 AACCACCCTAGGGTGAACTGAGG - Intergenic
926110152 2:10177520-10177542 AAGGAAGCTAGGGAGATCTGAGG - Intronic
927207608 2:20619912-20619934 ACGGAACCCAGTGAGAGCTGAGG + Intronic
927829476 2:26336751-26336773 AAGCAATCAAGGGAGAAGGGAGG + Intronic
928827105 2:35436400-35436422 AAGCAAAGCAGGGAGACCTGTGG + Intergenic
929471768 2:42200925-42200947 AGGCAGCCCATGGAGAACAGGGG - Intronic
929777734 2:44939136-44939158 TCGCCACTCAGGGAGAACTGAGG - Intergenic
929887111 2:45888769-45888791 GAGCAAGCCAGGGAGTACTGTGG + Intronic
932310147 2:70733259-70733281 AAGCAGCCGAGGGATCACTGGGG - Intronic
934660856 2:96142997-96143019 CGCCAGCCCAGGGAGAACTGGGG + Intergenic
934935777 2:98464280-98464302 CAGCAACCCAGGGGAAGCTGAGG + Intronic
939616496 2:144367340-144367362 AAGCATCGCAGGGAGAAAGGAGG - Intergenic
941206602 2:162580822-162580844 GAGCAACCCTGTGGGAACTGAGG + Intronic
943311183 2:186326588-186326610 CAGGAACCCTGGGAAAACTGAGG + Intergenic
944366037 2:198920504-198920526 AGGCAAGCCAAGAAGAACTGAGG + Intergenic
944542721 2:200768775-200768797 AAGAAACCCATGGAGCCCTGTGG + Intergenic
946410643 2:219513623-219513645 AAGCAAGCCAGGGAGCAAAGGGG - Intergenic
947930684 2:233962446-233962468 AGGAAACCAATGGAGAACTGAGG - Intronic
948567700 2:238897203-238897225 CTGCAACCAAGGGAGAAGTGCGG - Intronic
948944971 2:241214910-241214932 ATGCCACCCAGGGAGGAGTGGGG - Intronic
1168920502 20:1531152-1531174 TAACAACTCAGGGAGAACTTCGG + Intergenic
1170029638 20:11931495-11931517 AAGCTACCCAGGGTGCAGTGGGG + Intergenic
1171264383 20:23759039-23759061 AAACAACACAAGTAGAACTGGGG - Intergenic
1171882864 20:30631178-30631200 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
1172843792 20:37917619-37917641 CAGCACGCCAGGGAGAGCTGTGG + Intronic
1173030872 20:39358483-39358505 AAACAGACCAGGGAGCACTGGGG - Intergenic
1173178119 20:40780615-40780637 AAGGGAGCCAGGGAGTACTGGGG + Intergenic
1174423249 20:50414503-50414525 AAGGTATCCAGGGAGAAGTGAGG - Intergenic
1176842112 21:13849937-13849959 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
1177871181 21:26574603-26574625 AAACAACCAAGAGATAACTGAGG + Intergenic
1178448682 21:32670954-32670976 AAGCAGCCCAGGGAGACTTCGGG + Intronic
1179521949 21:41951435-41951457 AAGCAACCCAGGGCCATCTCTGG - Intronic
1182813782 22:33139989-33140011 AAGCAAGCCAAGGAGACCAGAGG - Intergenic
1182835909 22:33341191-33341213 AAGCAAGCAAGGGAGCACTTTGG - Intronic
1184331093 22:43828369-43828391 GAGCAACCCAGGTGGATCTGGGG + Intronic
1184679871 22:46064776-46064798 GAGTAACCCAGGGAGAACGCAGG + Intronic
1184774004 22:46614298-46614320 AACCAACACAAGGAGAAGTGAGG - Intronic
1184820856 22:46908305-46908327 GAGAATCCCAGGGAGACCTGCGG - Intronic
950097567 3:10338834-10338856 AAGTAACCCCAGGAGAACCGAGG - Intronic
950469569 3:13176131-13176153 GAGCAACTCAGGAGGAACTGAGG + Intergenic
950559442 3:13713339-13713361 AGGCCACCTAGGGAGAACTGAGG + Intergenic
951002959 3:17585482-17585504 AAAGAACCCAGGAAGGACTGTGG + Intronic
951685253 3:25336760-25336782 AAGCAATACCGGGAGAATTGGGG + Intronic
953549253 3:43888044-43888066 AAGCAACCAAGGGTGATCTCTGG - Intergenic
954132948 3:48569435-48569457 AACCAACCCAGGGTGAACGAGGG - Exonic
955060933 3:55490830-55490852 AAGCAGCCCAGTGAGGTCTGGGG - Intergenic
957018650 3:75098829-75098851 AAGGGACTCAGGGAGAAGTGGGG - Intergenic
957273598 3:78062522-78062544 AACCATCCCAGTGAGAAGTGGGG - Intergenic
959447419 3:106457439-106457461 CAGCAGCCCATGCAGAACTGAGG + Intergenic
959988103 3:112599360-112599382 ACACAACTCAGAGAGAACTGAGG + Intergenic
960985437 3:123276913-123276935 AAGCAAGCAAGGCAGAGCTGGGG - Intergenic
960991888 3:123317361-123317383 AAGCAGCCCAGGGAATACTTTGG + Intronic
961373703 3:126448720-126448742 GGGCCACCCAGGAAGAACTGGGG + Intronic
965598747 3:170434293-170434315 AAGAAACCTAGAGAGCACTGAGG - Intronic
966364396 3:179167942-179167964 AAGCAACAGATGAAGAACTGAGG - Intronic
967051643 3:185790126-185790148 AAGCAGTCCAGGGTGAGCTGAGG - Intronic
968350081 3:198046494-198046516 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
971300579 4:25439181-25439203 AGGTAAACCAGGGAGAACTTTGG + Intergenic
973366543 4:49213582-49213604 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
973394066 4:49578817-49578839 AGGCAACCAAGGCAGAGCTGAGG - Intergenic
973607183 4:52599497-52599519 GAGCAAGCCAGGAAGAAATGGGG + Intronic
974184860 4:58431797-58431819 ACTCAACCCACAGAGAACTGAGG - Intergenic
978025519 4:103868122-103868144 ACTCCACCCATGGAGAACTGAGG - Intergenic
978728241 4:111996097-111996119 CAGGAACCCAGAGAGACCTGAGG + Intergenic
979553442 4:122017532-122017554 AAGCACCCCAGGGACCACTTAGG + Intergenic
980655045 4:135771654-135771676 ATGCACACCATGGAGAACTGTGG + Intergenic
981744999 4:148044422-148044444 ACACAGCCCAGGGAGGACTGAGG + Intronic
984089128 4:175348628-175348650 AATGAACCCAGGAAGAACGGTGG + Intergenic
984383326 4:179023540-179023562 AAGCAACTAAGTCAGAACTGAGG - Intergenic
984778249 4:183503339-183503361 AAGCAACCCAGACAGTACAGTGG - Intergenic
1202764051 4_GL000008v2_random:136119-136141 AGGCAACCAAGGCAGACCTGAGG + Intergenic
987862983 5:23508805-23508827 GAGCACCCCAGGGAGATTTGAGG - Intronic
989687076 5:44102446-44102468 AATCCACAAAGGGAGAACTGAGG + Intergenic
990045405 5:51424459-51424481 AAGGAACTAGGGGAGAACTGAGG + Intergenic
990635057 5:57716090-57716112 AAGCAAAGCTGGAAGAACTGAGG - Intergenic
991112819 5:62920670-62920692 ATGCATGCCATGGAGAACTGTGG + Intergenic
992135378 5:73738732-73738754 AATCAATCCATGGAGACCTGGGG + Intronic
992266015 5:75018878-75018900 AAGCACCACAGGGAGGGCTGGGG + Intergenic
995011050 5:107257690-107257712 AAGCAAGCCTGGGAGAAATTTGG + Intergenic
999327284 5:150651054-150651076 CAGCAAGCCAGGTAGAACTGGGG - Exonic
999699897 5:154218706-154218728 AAGCAGCCCAGACAGAATTGGGG + Intronic
999747063 5:154600601-154600623 CGGCTACCCAGGGAGAGCTGGGG + Intergenic
1000269733 5:159672645-159672667 AAGCAGCCCAGGTACAACTCAGG + Intergenic
1001060807 5:168486943-168486965 CAGTAACCCGGGAAGAACTGCGG - Intronic
1001780819 5:174367634-174367656 AAGCAACCAAGAGTAAACTGTGG - Intergenic
1003722214 6:8716670-8716692 AAGGTTCCCAGGGAAAACTGTGG - Intergenic
1004114306 6:12750584-12750606 AAGCAACAGAAGGAGGACTGAGG + Intronic
1004630015 6:17412156-17412178 AGGGAGCCCAGTGAGAACTGAGG - Intronic
1005016501 6:21379797-21379819 TAGCAAGCCCAGGAGAACTGGGG + Intergenic
1006982010 6:38154652-38154674 CAGCAACCCAGGGGGCACTTAGG - Intergenic
1007387323 6:41528590-41528612 AAGAAACTCAGGGGAAACTGAGG + Intergenic
1009772091 6:68156758-68156780 AAGCAGCCCATGAAGAACCGAGG + Intergenic
1009772690 6:68163321-68163343 TACCAACCCATGGGGAACTGTGG - Intergenic
1012075727 6:94682492-94682514 AAGCAAAACAGGCTGAACTGAGG + Intergenic
1012998027 6:105992914-105992936 AAACAAACCAGAGAGAACTGAGG - Intergenic
1013157635 6:107508723-107508745 AATCAACCAAAGGAGAACAGGGG - Intronic
1013797009 6:113899473-113899495 AAGCAGGCCAGGTAGAACAGAGG - Intergenic
1016286109 6:142474670-142474692 AAGCAAGCCAGGGAGAAGAAAGG - Intergenic
1016326201 6:142904875-142904897 AAGTAACCCTGGGTAAACTGTGG + Intronic
1017210123 6:151846533-151846555 AAGGAAAACAGGGAGAGCTGCGG - Intronic
1017788103 6:157772932-157772954 AGGCCACCCAGGGAGAATGGTGG + Intronic
1018703208 6:166444373-166444395 AACCAACCCAGGGAGACTAGTGG - Intronic
1018939868 6:168301935-168301957 GAGCAATCCAGGGAGAAGAGCGG - Intronic
1019061135 6:169259107-169259129 AAGCACCCCAAGGTGATCTGGGG + Intergenic
1019061691 6:169262082-169262104 AAGCACCCCAAGGTGATCTGGGG - Intergenic
1019207397 6:170373969-170373991 AAACAATCCAGGTAGAACTGAGG - Intronic
1019207403 6:170374021-170374043 AAAAAATCCAGGTAGAACTGAGG - Intronic
1019662065 7:2230119-2230141 AAGCAACCATGGAAGACCTGGGG - Exonic
1020066725 7:5194054-5194076 ATGCAGCCAAGGGAGAACTTAGG + Intronic
1021200966 7:17728304-17728326 AAGCTACCCAGAAAGAACAGGGG - Intergenic
1021609608 7:22444600-22444622 CAGCAACCCTGGGAGAAATAAGG + Intronic
1022308374 7:29172123-29172145 AAGGAACCCAGGGAGTACCTAGG + Intronic
1022870886 7:34478512-34478534 AAGAAAGTCAGGGAGAACTGGGG + Intergenic
1023628212 7:42137491-42137513 AAGCTGCCCTGGGAGATCTGAGG - Intronic
1023733856 7:43217969-43217991 AAGCCTCCCAGGGAGGCCTGTGG + Intronic
1025032589 7:55570049-55570071 AAGCAACCCAGGGAGCTATTTGG - Intronic
1027006597 7:74699250-74699272 AAGGAACCCAGGAGGAAGTGTGG + Intronic
1027505850 7:79016531-79016553 AAGCAACTCAGGGGAGACTGTGG - Intronic
1030417418 7:109262914-109262936 AAGCAACCCAGGGATCACCTGGG + Intergenic
1030884136 7:114918557-114918579 AGACAACCCAGGGGGATCTGGGG + Intergenic
1033246081 7:139717338-139717360 AAGCAACCCAGGGAGAACTGAGG - Intronic
1034292887 7:149946523-149946545 AACCAATCCTGGGAGAACAGGGG - Intergenic
1034820519 7:154212483-154212505 AAGCAACCCAGGGAGAGGGCAGG + Intronic
1034918918 7:155062815-155062837 AAGCAAACCAAGAATAACTGTGG + Intergenic
1037059294 8:14486518-14486540 AAGCCACTCATGGAGAACTTAGG + Intronic
1037887995 8:22605038-22605060 AGGCCACCAAGGGAGGACTGAGG - Intronic
1039198721 8:35061957-35061979 AAGCAGCCATGGCAGAACTGGGG - Intergenic
1041170763 8:55140135-55140157 TACCAACCCAGGAATAACTGAGG - Exonic
1041787324 8:61649338-61649360 AAGCAATCTGGGGAGAACTGGGG + Intronic
1043441401 8:80279761-80279783 AACCCCCCCAGGGAGAACAGAGG + Intergenic
1045370866 8:101521328-101521350 AAGCAGCCCATGGCGAAGTGTGG + Intronic
1046737642 8:117794213-117794235 AAGCAGGCCAGGGTGAACAGTGG - Intergenic
1048840758 8:138563957-138563979 AAGCAACACATGGAGCACTTAGG - Intergenic
1049024796 8:139980880-139980902 AAGCCACCCACGGACAACAGAGG + Intronic
1049145635 8:141000162-141000184 AAGGAACCCAGAGAGAAATTCGG + Intronic
1049481296 8:142824831-142824853 AAGCAATCCAAGGAAAGCTGTGG - Intergenic
1049839620 8:144762718-144762740 AAGCAAGCCCGGGAGGACAGGGG + Intergenic
1049860322 8:144893888-144893910 CAGCCATCCAGGGAGTACTGAGG - Intronic
1050587159 9:7124765-7124787 AAGCAACCCAGTAATCACTGGGG + Intergenic
1051720559 9:20032791-20032813 ACCCAACCCAGGGAGGAGTGGGG + Intergenic
1052325432 9:27212567-27212589 ACACCACCCAGGGAGCACTGGGG - Intronic
1052535494 9:29740713-29740735 AACCAACTCAGGGAGAAGTGGGG + Intergenic
1052880653 9:33599326-33599348 AGGCAACCAAGGCAGAGCTGAGG - Intergenic
1053495320 9:38544884-38544906 AGGCAACCAAGGCAGAGCTGAGG + Intronic
1053666866 9:40323138-40323160 AGGCAACCAAGGCAGAGCTGAGG - Intronic
1053916458 9:42948245-42948267 AGGCAACCAAGGCAGAGCTGAGG - Intergenic
1054378018 9:64463166-64463188 AGGCAACCAAGGCAGAGCTGAGG - Intergenic
1054517743 9:66053145-66053167 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
1055985910 9:82056427-82056449 CAGCAACCAAGGCAGAGCTGAGG - Intergenic
1056585430 9:87924703-87924725 AGGCAACCAAGGCAGAGCTGAGG + Intergenic
1056611449 9:88128240-88128262 AGGCAACCAAGGCAGAGCTGAGG - Intergenic
1057675217 9:97132242-97132264 AAGCAACCAAGGCAGAGCTGAGG + Intergenic
1062235447 9:135505741-135505763 GAGCAGCCCAGGCAGAGCTGTGG + Intergenic
1203544800 Un_KI270743v1:120992-121014 AGGCAACCAAGGCAGACCTGAGG + Intergenic
1186126324 X:6418391-6418413 AAGCACCCCAGGGCAAACTGTGG + Intergenic
1186516097 X:10167020-10167042 AAGGAACACAGGGAGTGCTGGGG + Intronic
1188444274 X:30240175-30240197 AGGAAACCGAGTGAGAACTGAGG + Intergenic
1188775069 X:34206735-34206757 AAGCAAGCAAGGAAGAAATGAGG - Intergenic
1189004121 X:36977919-36977941 AAGAAACCCAGTGAGAACACAGG + Intergenic
1190032029 X:46983333-46983355 AGGCAAACCTGGGAGACCTGGGG - Intronic
1190738263 X:53269921-53269943 AAGGAGCCCAGGAAGAAATGGGG - Intronic
1192040317 X:67613336-67613358 AGTCACCTCAGGGAGAACTGTGG - Intronic
1196032119 X:111102345-111102367 AAGAAACCTGGGGAGTACTGTGG + Intronic
1196559894 X:117133304-117133326 AAGCTAGCCAGGAAGAACTTTGG - Intergenic
1197467733 X:126825700-126825722 AAGCAACACAGGGAGTATGGGGG + Intergenic
1199862812 X:151817054-151817076 GAGCAACCCTGGGGGAAGTGGGG - Intergenic
1200146726 X:153930231-153930253 CAGGAACCCAGGGAGAAGCGGGG + Intronic
1201454884 Y:14159060-14159082 AAGCAAGCCATTGAGATCTGGGG + Intergenic