ID: 1033246084

View in Genome Browser
Species Human (GRCh38)
Location 7:139717354-139717376
Sequence GTTGCTTTCTACTGAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033246081_1033246084 -7 Left 1033246081 7:139717338-139717360 CCTCAGTTCTCCCTGGGTTGCTT 0: 1
1: 0
2: 1
3: 46
4: 273
Right 1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033246084 Original CRISPR GTTGCTTTCTACTGAAACTC AGG Intronic
901797684 1:11690223-11690245 GTTGTTTACTACTGTACCTCCGG + Intronic
904797326 1:33066500-33066522 GCTGCTTTCTAAAGAAAATCTGG + Intronic
908837482 1:68242466-68242488 TTTGTTTACTATTGAAACTCTGG + Intergenic
909881039 1:80878941-80878963 GTTACTTTTAAATGAAACTCTGG + Intergenic
910016060 1:82525874-82525896 ATTGCTTTCTACTCATACACAGG - Intergenic
910207635 1:84764117-84764139 GTTTCTTTCTAATGCAAGTCAGG + Intergenic
910424675 1:87108817-87108839 GTAGCTTTCTATTGAGAGTCAGG + Exonic
911054003 1:93695441-93695463 GTGGGTTTCTACTGAACCACAGG - Intronic
911717751 1:101154000-101154022 TATGCTTACTACTCAAACTCTGG + Intergenic
911978570 1:104535524-104535546 GTTTCTTTCCACTGCAATTCCGG + Intergenic
918887470 1:190213940-190213962 GTTGCTTTCTGCCCAAACACTGG - Intronic
920165580 1:204033272-204033294 GTTTCATTCTACTGATTCTCTGG - Intergenic
920801233 1:209189583-209189605 GTTCCTTTCTGGTGAAACTTGGG - Intergenic
922988206 1:229883037-229883059 TCTGTTTCCTACTGAAACTCTGG + Intergenic
924481581 1:244439907-244439929 GTTGCTTTCTACTGTGACAAGGG + Intronic
1068410778 10:56651368-56651390 GAAGCTTCCTACAGAAACTCTGG + Intergenic
1071775687 10:88785408-88785430 AATGCTTTCTACATAAACTCTGG + Intergenic
1074451094 10:113560178-113560200 TTTGCTTTCACCTGAAGCTCAGG - Intronic
1078325983 11:10381128-10381150 GTTGCTCTTGACTGAAGCTCTGG - Intronic
1084143685 11:67251468-67251490 GTTGGTTTTTCCTTAAACTCTGG + Intronic
1086452636 11:86932255-86932277 GTCGTTTTCTACTGAAAATTAGG + Intronic
1086666130 11:89485188-89485210 GATTCTTTCTAGTGAAACACTGG - Intronic
1086998512 11:93388311-93388333 CATGCTTTCTACTGGAAGTCAGG - Intronic
1089478528 11:118786745-118786767 GTCTCTTTCTACTTAATCTCTGG - Intronic
1092094787 12:5832502-5832524 GTTGCTGTGTTCTGGAACTCGGG + Exonic
1098088314 12:66872511-66872533 GTTTCTTTCAACTAAAAATCTGG + Intergenic
1098258977 12:68647775-68647797 GTTCCTTACTTCTGAAACTCAGG - Intronic
1099134567 12:78879807-78879829 GTTCCTTTGTTCTGATACTCTGG + Intronic
1099309550 12:81001249-81001271 GCTGCTTACTACAGAAACTCTGG - Intronic
1099717981 12:86321443-86321465 GTTGATTTCTACTGAGCTTCAGG + Intronic
1100407269 12:94282645-94282667 GTTCTTTTCTGCTGAACCTCAGG - Intronic
1101098786 12:101371275-101371297 GTTGCTTTATGCTGAGACTTGGG + Intronic
1106247789 13:27963586-27963608 GTTGCTTTGAAAAGAAACTCAGG - Intronic
1106249673 13:27973976-27973998 CTTCCTTTCTTCTGAAACTAGGG + Intergenic
1108243321 13:48489926-48489948 AATGCTTTCTACATAAACTCTGG + Exonic
1111486449 13:88907059-88907081 CTTACTCCCTACTGAAACTCAGG - Intergenic
1115001473 14:28425537-28425559 GTTTATTTCCACTAAAACTCAGG - Intergenic
1115521235 14:34234853-34234875 GCAGCTTTCTGCTGAATCTCTGG - Intronic
1115816418 14:37168993-37169015 CTTGCGTTCAACTGAAACTAGGG - Intronic
1115965162 14:38879584-38879606 GTTGCTTTCTACTGCAATGGTGG + Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1125743286 15:41982365-41982387 ATTGCTTCCTAATGAATCTCTGG - Exonic
1125980015 15:43992062-43992084 TTTGCTTTCTACTATAATTCTGG + Intronic
1126886294 15:53154574-53154596 GTGGTTTTATTCTGAAACTCTGG - Intergenic
1128208181 15:65870638-65870660 GTTGCTTCCTGCTGCAACGCTGG + Intronic
1128858120 15:71038379-71038401 TTTGCTTTCTTCTGATACACTGG - Intronic
1137490535 16:48928605-48928627 GTTGCTTCCTTCTGAAGCTGAGG - Intergenic
1140259072 16:73361771-73361793 ATTGCTTCCTACTGCAACTTTGG + Intergenic
1143911132 17:10250514-10250536 CTTTCTTTCTACTGAACTTCTGG - Intergenic
1156695914 18:39767224-39767246 GATGCTTTCTCCTGAAGATCTGG + Intergenic
1157022867 18:43807720-43807742 TATGCTTTCTACTTAAACTGTGG - Intergenic
1161305940 19:3568112-3568134 TTTGCTTACAATTGAAACTCTGG + Intronic
1166439251 19:42796857-42796879 GTTTTTTTCTACTGAAAATAAGG + Intronic
1167973450 19:53204348-53204370 GTTTATTTCTACTTAAGCTCTGG - Intergenic
926469972 2:13242740-13242762 GTTGCTTCTTATTCAAACTCAGG - Intergenic
926938522 2:18111603-18111625 ATTGCTTACTTCTGAAAATCAGG + Intronic
931532789 2:63235456-63235478 GTTGCCTTCTACTTAATTTCTGG - Intronic
939258911 2:139781648-139781670 TTCCCTTCCTACTGAAACTCGGG - Intergenic
940015227 2:149097433-149097455 GTTGCTATTTACTGTAATTCGGG - Intronic
944147114 2:196517828-196517850 GCTGCTGTATCCTGAAACTCTGG - Intronic
945610685 2:211997938-211997960 ATTGCATTCTACCTAAACTCAGG - Intronic
946087216 2:217186132-217186154 ATTACATTCTACTGAAACTAGGG + Intergenic
947689688 2:232123262-232123284 GTTGCTTTTCATTAAAACTCAGG + Intronic
1170874060 20:20234404-20234426 GTTGCCTTTTACTGAAACTTTGG + Intronic
1174370511 20:50084064-50084086 GTTGCTTTGTACTTAACATCAGG - Intronic
1174578862 20:51556781-51556803 GTTTCTTTCCCCTGACACTCCGG - Intronic
1177081363 21:16642174-16642196 GTTGGTTTTTCCTGAAACTTAGG + Intergenic
1183730198 22:39614289-39614311 GTTTCTGTCAACTGGAACTCAGG - Intronic
949392487 3:3578237-3578259 ATTCCTTGCTACTGAAACTGTGG + Intergenic
949915127 3:8955423-8955445 GTTGCTTGCTACTGATCCACAGG + Intronic
952583075 3:34857519-34857541 GTTGCTTTTTACTGAATACCAGG + Intergenic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
961077363 3:123994303-123994325 GTTGCTTTCTTCTAAAACAGAGG + Intergenic
961307220 3:125967003-125967025 GTTGCTTTCTTCTAAAACAGAGG - Intergenic
968052439 3:195664343-195664365 GTTGCTTTTTACGCAATCTCTGG - Intergenic
968103371 3:195983997-195984019 GTTGCTTTTTACGCAATCTCTGG + Intergenic
968301678 3:197621589-197621611 GTTGCTTTTTACGTAATCTCTGG + Intergenic
970145489 4:13031479-13031501 TTTGCATTCTGCTGACACTCAGG - Intergenic
972143797 4:35995792-35995814 GTTCCCTTCTGCTGAAACTATGG - Intronic
983365537 4:166782616-166782638 ATTGATTTCTACTGTAATTCTGG - Intronic
984018280 4:174452319-174452341 ATTACTTGGTACTGAAACTCTGG + Intergenic
985498645 5:226139-226161 GTTGCTTTTTACGTAATCTCTGG - Intronic
987140301 5:14938998-14939020 TTTCCTTTCCACTGAAAATCTGG - Intergenic
987161407 5:15147872-15147894 GTTACTGTGTAATGAAACTCTGG + Intergenic
987969492 5:24923787-24923809 GATGCTTTCTACAGAAAAGCTGG - Intergenic
988536021 5:32069547-32069569 TTTGCTTTCTGCTGAAAATCAGG + Exonic
988920634 5:35938566-35938588 GTTGCTTCGAACTGAAACTATGG + Intronic
989250878 5:39313670-39313692 CTTGTTTTCTATTGAAATTCAGG + Intronic
992522569 5:77570407-77570429 GTTGCTTACAAATGAAACTAGGG + Intronic
994211767 5:97095057-97095079 GTTGCTTTTTATTGACACCCTGG - Intronic
995410151 5:111848017-111848039 GTTGAGTTTTACTGAAGCTCAGG - Intronic
996882717 5:128318166-128318188 GTTGGGTTCAACTGAAAATCGGG + Exonic
997706976 5:135964840-135964862 GGTTCTTTCCACTGAAACACAGG - Intergenic
999492901 5:152069144-152069166 ATTACATTTTACTGAAACTCAGG - Intergenic
999729077 5:154462221-154462243 TTTGCTTTCTAAAGCAACTCAGG - Intergenic
1000181337 5:158814386-158814408 GTTGCTTTCTACTTATATTTTGG - Intronic
1001532469 5:172473316-172473338 TTTGCTTTCAACTTAAACTGTGG - Intergenic
1003270495 6:4603480-4603502 GGTGGTTTCTACCAAAACTCCGG + Intergenic
1009435416 6:63612753-63612775 TTTGTTTACAACTGAAACTCTGG + Intergenic
1010040334 6:71374609-71374631 GTGACATTCCACTGAAACTCTGG - Intergenic
1010375173 6:75160356-75160378 ATTGCTTTCACCTGAAACTCAGG - Intronic
1013566087 6:111364802-111364824 ATTATTTACTACTGAAACTCTGG - Intronic
1015068507 6:129060344-129060366 GTTGCTTTCAAGTTAAACTTGGG + Intronic
1016755470 6:147680575-147680597 GTTGCTTTGTACTTAATCTTAGG + Intronic
1019156265 6:170040929-170040951 GTTCCTTTCTGCTGCATCTCAGG + Intergenic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1021738919 7:23665823-23665845 GTTGCCTTTTACTGAAACAGGGG - Intergenic
1024783425 7:52878209-52878231 GTTGCTTACTAGTGAAGCACTGG - Intergenic
1028825612 7:95269866-95269888 GTTAGTGTTTACTGAAACTCTGG - Intronic
1031034665 7:116775400-116775422 TTTACTTTCTTCTAAAACTCAGG + Intronic
1031781466 7:125972490-125972512 GTTTATTTCTACTGCAACTTTGG + Intergenic
1032156233 7:129470694-129470716 GGAGCTTACTACTGAAAGTCTGG + Exonic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1033504865 7:141989747-141989769 GATGATTTCAACTGAAAATCTGG - Intronic
1035912852 8:3587097-3587119 ATTGCTTTCTTCTAAAACACAGG - Intronic
1037967334 8:23145031-23145053 GTTGGTTTCTCCAGAAACTGGGG - Intronic
1043019941 8:74987772-74987794 GTTGCTTTTTACTTAAAATAAGG + Intronic
1043386310 8:79751153-79751175 GATGCTTTCTTCTGAAACTATGG - Intergenic
1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG + Intronic
1050375266 9:4965448-4965470 CTTGCTTTCTTTTAAAACTCAGG - Intergenic
1050728473 9:8679162-8679184 GTCGCTTCCTACTGAATTTCTGG + Intronic
1051976549 9:22957103-22957125 GTTGCTTTTTACTGCAAATGTGG + Intergenic
1052381651 9:27778141-27778163 GCTGCTTTCTACTGGAACCAAGG - Intergenic
1053336964 9:37283315-37283337 TTTGTTTTCTCCTGAAACTATGG - Intronic
1056502508 9:87223678-87223700 GAAGATTTCTCCTGAAACTCAGG + Intergenic
1056737518 9:89222733-89222755 GGTGCTCTATAGTGAAACTCAGG - Intergenic
1186374645 X:8986380-8986402 GTTGCATTCTTATGAGACTCTGG - Intergenic
1187135899 X:16547058-16547080 ATTGCTTTCTACTGAAATATCGG - Intergenic
1196892416 X:120304293-120304315 CTTGCTGTCTACAGAAATTCTGG - Intronic
1198988946 X:142489047-142489069 GTTACCATCTTCTGAAACTCAGG - Intergenic
1199435596 X:147809133-147809155 TTTGCTTTTTACTGAAAATTGGG - Intergenic