ID: 1033246085

View in Genome Browser
Species Human (GRCh38)
Location 7:139717357-139717379
Sequence GCTTTCTACTGAAACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033246081_1033246085 -4 Left 1033246081 7:139717338-139717360 CCTCAGTTCTCCCTGGGTTGCTT 0: 1
1: 0
2: 1
3: 46
4: 273
Right 1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033246085 Original CRISPR GCTTTCTACTGAAACTCAGG AGG Intronic
No off target data available for this crispr