ID: 1033246443

View in Genome Browser
Species Human (GRCh38)
Location 7:139720361-139720383
Sequence CCCTGGGCCCATGGATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033246430_1033246443 28 Left 1033246430 7:139720310-139720332 CCTAGGGGCAGTTCTGCTAACAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG No data
1033246432_1033246443 5 Left 1033246432 7:139720333-139720355 CCAGCACCTGATTGGAGCCCCAC 0: 1
1: 0
2: 0
3: 17
4: 133
Right 1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG No data
1033246433_1033246443 -1 Left 1033246433 7:139720339-139720361 CCTGATTGGAGCCCCACCTCCAC 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033246443 Original CRISPR CCCTGGGCCCATGGATCTGC TGG Intronic
No off target data available for this crispr