ID: 1033248062

View in Genome Browser
Species Human (GRCh38)
Location 7:139735461-139735483
Sequence TGCTAGGCTGAGGACTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033248058_1033248062 8 Left 1033248058 7:139735430-139735452 CCTTAAATTTATGGAGTCAAATT 0: 1
1: 0
2: 6
3: 28
4: 295
Right 1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 118
1033248057_1033248062 16 Left 1033248057 7:139735422-139735444 CCAATAATCCTTAAATTTATGGA 0: 1
1: 0
2: 0
3: 19
4: 363
Right 1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 118
1033248055_1033248062 17 Left 1033248055 7:139735421-139735443 CCCAATAATCCTTAAATTTATGG 0: 1
1: 0
2: 2
3: 20
4: 281
Right 1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033248062 Original CRISPR TGCTAGGCTGAGGACTGTAG AGG Intronic
908095175 1:60730071-60730093 GGCTTGGTTGAGTACTGTAGAGG - Intergenic
908323535 1:63001468-63001490 TGCTAGGCTGATGTCTGCCGCGG + Intergenic
908983109 1:69982866-69982888 TCATAGCCTGAGGACTGTAAAGG - Intronic
912414699 1:109500010-109500032 TGCTAGGCTGAGACCTATGGTGG + Intronic
917294248 1:173502489-173502511 TGCAGGGCTCATGACTGTAGAGG - Intronic
919316292 1:195974692-195974714 TAATTGGCTGATGACTGTAGTGG - Intergenic
923899651 1:238311876-238311898 TGATAGGCAGAGAATTGTAGAGG + Intergenic
1064358095 10:14637896-14637918 TGCTAGGCTGAGGTCTCCACTGG - Intronic
1069409338 10:68136474-68136496 TGCTATGCTGAAGACTTTTGAGG - Intronic
1070354199 10:75623507-75623529 GGCCAGGCTGAGGACTCCAGAGG + Intronic
1071023344 10:81083642-81083664 CCCTAGCCTGAGGACAGTAGGGG + Intergenic
1071289270 10:84176881-84176903 AGCCTGGCTGAGGACTGTGGAGG + Intronic
1075191621 10:120314933-120314955 TGCTCCTCTGAGGGCTGTAGGGG + Intergenic
1077187895 11:1243633-1243655 TGCTAGGGTGAGGGCTGGAAAGG - Exonic
1077188319 11:1245304-1245326 TGCTAGGGTGAGGGCTGGACAGG - Exonic
1077188851 11:1247404-1247426 TGCTAGGGTGAGGGCTGGACAGG - Exonic
1077189273 11:1249075-1249097 TGCTAGGGTGAGGGCTGGACAGG - Exonic
1077276030 11:1708981-1709003 TGCCCTGCTGAGGACTGAAGAGG - Intergenic
1077279808 11:1738338-1738360 TGGTAAGCTGAGGAGTGTACTGG + Intronic
1080800167 11:35603020-35603042 CTCTAGGCTGGGGGCTGTAGAGG - Intergenic
1084194458 11:67516550-67516572 TGCCAGGCTGAGGCCTGGGGAGG + Intergenic
1088352066 11:108900721-108900743 TGCTAACCTGATGACTGTATGGG - Intronic
1089401974 11:118169541-118169563 TGCAAGCCTGAGGAAGGTAGGGG - Intronic
1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG + Intronic
1090814971 11:130284824-130284846 TCCCAGGCTGTGGAGTGTAGTGG - Intronic
1095951588 12:47784619-47784641 TGCTGGGCTGAGCACTGGTGGGG - Intronic
1097690128 12:62727235-62727257 TGCTATGCTGGGCACTGGAGTGG - Intronic
1097958558 12:65510883-65510905 TGCTGGGCTGAGGTCTGGGGAGG + Intergenic
1100291159 12:93215988-93216010 ACCTAGGCTCAGGACTGTAGAGG - Intergenic
1100435629 12:94569043-94569065 TGCTAGGCTGAGCACTGGAATGG + Exonic
1102552366 12:113700956-113700978 AGCCAGGCTGAGGACTGTGGAGG - Intergenic
1105733023 13:23238263-23238285 TGCAAGGCGGAGTACTGCAGAGG + Intronic
1110524011 13:76514674-76514696 TTGTAGGTTGAGGACTATAGAGG + Intergenic
1112540288 13:100304143-100304165 TGGTGGGATGAAGACTGTAGGGG - Intronic
1113053790 13:106244348-106244370 TTCTGGGCTGAGGACTTTAGGGG + Intergenic
1113930028 13:113963369-113963391 GGCGAGGCTGAGGACGGGAGAGG - Intergenic
1114378694 14:22177336-22177358 TGATAGGCTGAGGACAGTCTAGG + Intergenic
1114819306 14:25997313-25997335 TGCTATGCTAAGGACTTTAATGG + Intergenic
1115804694 14:37037737-37037759 TTCTGGGCTGGGGAATGTAGAGG - Intronic
1122150784 14:99725135-99725157 TGCTGGGCTCAGCCCTGTAGGGG - Intronic
1122854603 14:104554155-104554177 TCCCAGGCTGAGGACTGGAGGGG - Intronic
1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG + Intronic
1127825443 15:62698745-62698767 TGCTGGGCTGAGGTCTGCAAAGG - Exonic
1128963836 15:72037497-72037519 CGCTTGGCTGAGTACTGAAGGGG + Intronic
1129670326 15:77604378-77604400 GGCTAGGCTGAGGGCAGGAGTGG - Intergenic
1130872218 15:87980599-87980621 AGCTATGCTCAGGAATGTAGAGG + Intronic
1136642356 16:31577630-31577652 TGCTAGGCTGCACACAGTAGGGG - Intergenic
1140889136 16:79270256-79270278 TGCTGGCCTGAGGGCTGCAGGGG + Intergenic
1141513021 16:84524919-84524941 TCCCAGGCTGAGGGCTGCAGGGG - Intronic
1161679951 19:5675030-5675052 TGCCAGGATGAGGACGGGAGGGG + Intronic
1164398474 19:27886744-27886766 TGGCAGGCTAAGGACTGTATGGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1168636495 19:58001197-58001219 TGATGGGCTGAGGACTTTTGAGG - Intronic
930979584 2:57507164-57507186 TGCTGGGGTGAGGAGTGTATTGG + Intergenic
931893639 2:66704052-66704074 GGCTAGGCTCAGGAGAGTAGGGG - Intergenic
937350411 2:121156767-121156789 TGCTGGGCTGAGGACTGCGTGGG - Intergenic
939186109 2:138862659-138862681 TGCTAGGAAGAGAACTATAGTGG - Intergenic
942591604 2:177552644-177552666 TGCTGGGCGGAGAACTGCAGCGG - Exonic
942598729 2:177618582-177618604 TGCTGGGCCGAGAACTGCAGCGG - Exonic
943653977 2:190487940-190487962 TGCCAGGCTGGGGAGTGCAGTGG + Intronic
945020711 2:205568095-205568117 TGCTTGGATAAGGACCGTAGTGG + Intronic
948836772 2:240629641-240629663 TGCTGGGCTGGGGACTGGAGGGG + Intronic
1171220409 20:23392117-23392139 TGCTAGGCTCAGGGCTGTGATGG + Intronic
1172083087 20:32358131-32358153 TGCTAGGCGGAGGACGCGAGAGG + Intergenic
1173147156 20:40534748-40534770 TGCTTGGCTGAGGACAGGACTGG - Intergenic
1178898633 21:36581660-36581682 ACCTAGGCTGAAGAGTGTAGTGG - Intergenic
1179574775 21:42301247-42301269 TCCCAGGCTGAGCTCTGTAGAGG + Intergenic
1182282381 22:29225024-29225046 TCCTACGCTGAGGGCAGTAGGGG + Intronic
1183743807 22:39682076-39682098 TGCAGGGCTGAGGAATGTGGGGG + Intronic
1185355436 22:50366671-50366693 TGCTTGGCTGGAGACTGGAGTGG + Intronic
951062247 3:18222878-18222900 AGCTAGGCTGAGGAATGTGCTGG + Intronic
953544291 3:43852462-43852484 TGCAAGGCAGAGTACTGGAGAGG - Intergenic
954005703 3:47588715-47588737 AGCTAGGCTAGGGACTGTGGGGG - Intronic
955680321 3:61493620-61493642 TGCTAGGCTAAGGACAATGGGGG - Intergenic
957855428 3:85870347-85870369 TGCTAGGCTCAAGACTTTGGTGG - Intronic
958622903 3:96584500-96584522 TTCTAGACTATGGACTGTAGTGG - Intergenic
971202290 4:24521634-24521656 CGCTAGCCTGAGAACTGAAGTGG - Intronic
971220064 4:24697084-24697106 TCCTGGGCTGAGGACTGAACTGG + Intergenic
977183325 4:93904596-93904618 TCCTAGGCTGTGGAGTGCAGTGG - Intergenic
980044725 4:127974745-127974767 TGGGAGGCTGAGGAGGGTAGAGG + Intronic
981865841 4:149417930-149417952 TGCTAGGCTCAAGACTATATAGG - Intergenic
984647957 4:182240067-182240089 TGCTTTGCTGATGACTGCAGTGG + Intronic
984872146 4:184335299-184335321 TGATGGGGTGAGGACTGCAGTGG - Intergenic
986877181 5:12126053-12126075 TGCGAGGCTGCGGCCTGGAGTGG + Intergenic
987821425 5:22970966-22970988 TGCCAGCCTGAGGGCAGTAGGGG + Intergenic
988786027 5:34566008-34566030 TGATGGGCTGAGGCCTGTAGGGG + Intergenic
990370465 5:55113374-55113396 TCCTGGGCTGAGGACTCCAGAGG + Exonic
993559015 5:89380298-89380320 TGGTAGGTTGAGGAATGTACAGG + Intergenic
993636642 5:90352339-90352361 AGCTACTCAGAGGACTGTAGTGG + Intergenic
996089255 5:119335060-119335082 TGCCAAGCTGAGAACCGTAGTGG + Intronic
997846077 5:137287138-137287160 TGCTTGGCTGATGACTTTGGAGG - Intronic
998163729 5:139828472-139828494 TGCTATCCTGAGGTCTGCAGAGG + Intronic
1004405344 6:15327980-15328002 GGCTAGGCTGGGGATGGTAGGGG - Intronic
1004562656 6:16764721-16764743 TGCTCTGCTGAGGAATGTACTGG + Intergenic
1007781875 6:44259061-44259083 TCCTCGGCTCAGGACTGTACTGG + Exonic
1010926549 6:81752327-81752349 TGCGCGGCTGGGGACTGTAAGGG - Intronic
1014998323 6:128181703-128181725 TTCTGGGCTGAGGCCAGTAGTGG + Intronic
1019151035 6:170006071-170006093 TGCTAGGCTGAGACCTACAGAGG + Intergenic
1019340452 7:506605-506627 TGCCAGCCCGAGGACTGCAGGGG - Intronic
1020257498 7:6510293-6510315 TGCTGGGCTGGGGCCTGGAGGGG + Exonic
1022341139 7:29469323-29469345 TGCTGTGTTGATGACTGTAGGGG - Intronic
1026549238 7:71353068-71353090 TGCTAGCCTGAGGGCTTTGGGGG + Intronic
1027440879 7:78217869-78217891 TGGTAGCCTGGGGGCTGTAGTGG + Intronic
1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG + Intronic
1033797162 7:144859835-144859857 TTCTGGGCTGAGGATTATAGAGG + Intergenic
1037577753 8:20224049-20224071 TGTTAGCCTGGGGACTGTAAGGG + Intronic
1038642195 8:29337520-29337542 TGCTAGACCAAGGACTGGAGAGG + Intronic
1038784319 8:30597173-30597195 TGCTAGGCCCAGAACTTTAGTGG - Intronic
1040105166 8:43537558-43537580 TCCTAGGCTGAGACCTGTGGTGG + Intergenic
1041986040 8:63923369-63923391 TGGTAGGCTGAGGACTATGATGG + Intergenic
1044180551 8:89188480-89188502 TGCTAGGCTATGTACTGCAGAGG + Intergenic
1044305573 8:90636828-90636850 TCCTAGGTTGAGAAGTGTAGGGG - Intronic
1049014257 8:139908399-139908421 TGATAGGCTGAGGGTTGGAGAGG - Intronic
1049849782 8:144824678-144824700 TGGCAGGCTCAGGGCTGTAGGGG - Intergenic
1050243428 9:3661489-3661511 TGGCAGGCAGAGGACTGGAGAGG - Intergenic
1053334406 9:37251857-37251879 TGTTAGACTGAGGATTGTATTGG + Intronic
1057797879 9:98171431-98171453 TGCCATGCTGGGCACTGTAGGGG + Intronic
1060211716 9:121714645-121714667 TGCTAAGCTGAGGGATGTAATGG + Intronic
1062031976 9:134365851-134365873 TGCTAGGCTCAGGCCTGTCTTGG + Intronic
1062409444 9:136415435-136415457 TGCAAGGCTGAGGAGGGTAATGG - Intronic
1186728295 X:12381026-12381048 TCTTTGGCTGAGGACTCTAGAGG - Intronic
1193862140 X:86682143-86682165 GACTAGGCTGAGATCTGTAGTGG - Intronic
1195450043 X:105000998-105001020 TGCAAGGCTAAGGACTCCAGTGG - Intronic
1196582366 X:117392805-117392827 TGCTAGTCTGAGGGCAGTAAGGG - Intergenic
1199867142 X:151861918-151861940 TGATAGGCTGAGCACTCCAGAGG - Intergenic
1201466975 Y:14293063-14293085 TGAGAAGATGAGGACTGTAGTGG - Intergenic