ID: 1033249664

View in Genome Browser
Species Human (GRCh38)
Location 7:139747740-139747762
Sequence GGCACCCCCGGTTTTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033249660_1033249664 -6 Left 1033249660 7:139747723-139747745 CCTCCACTGGATATCCAGGCACC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249657_1033249664 4 Left 1033249657 7:139747713-139747735 CCTCCTGTGGCCTCCACTGGATA 0: 1
1: 0
2: 0
3: 26
4: 160
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249649_1033249664 19 Left 1033249649 7:139747698-139747720 CCCATCAGCCCCAGCCCTCCTGT 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249652_1033249664 11 Left 1033249652 7:139747706-139747728 CCCCAGCCCTCCTGTGGCCTCCA 0: 1
1: 1
2: 10
3: 68
4: 671
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249654_1033249664 9 Left 1033249654 7:139747708-139747730 CCAGCCCTCCTGTGGCCTCCACT 0: 1
1: 3
2: 6
3: 66
4: 683
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249653_1033249664 10 Left 1033249653 7:139747707-139747729 CCCAGCCCTCCTGTGGCCTCCAC 0: 1
1: 0
2: 8
3: 68
4: 531
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249661_1033249664 -9 Left 1033249661 7:139747726-139747748 CCACTGGATATCCAGGCACCCCC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249650_1033249664 18 Left 1033249650 7:139747699-139747721 CCATCAGCCCCAGCCCTCCTGTG 0: 1
1: 0
2: 2
3: 83
4: 634
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249658_1033249664 1 Left 1033249658 7:139747716-139747738 CCTGTGGCCTCCACTGGATATCC 0: 1
1: 0
2: 0
3: 5
4: 187
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249648_1033249664 28 Left 1033249648 7:139747689-139747711 CCAGGGTGACCCATCAGCCCCAG 0: 1
1: 0
2: 2
3: 27
4: 314
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1033249656_1033249664 5 Left 1033249656 7:139747712-139747734 CCCTCCTGTGGCCTCCACTGGAT 0: 1
1: 1
2: 3
3: 29
4: 255
Right 1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033249664 Original CRISPR GGCACCCCCGGTTTTTCCCT TGG Intronic
902624787 1:17670269-17670291 GGCACCCGCGGTCTGTCTCTGGG + Intronic
904030105 1:27528259-27528281 GGCGCCCCCGGCGTTCCCCTAGG - Intergenic
904320815 1:29696934-29696956 GGCACCCCTGGTTCTCCCCAGGG + Intergenic
909285797 1:73815598-73815620 GGCACTCCCAGTATTTCCCATGG - Intergenic
914439351 1:147690305-147690327 GGCAACCTCTGTTTTTTCCTAGG - Intergenic
920202539 1:204268404-204268426 GGCACCCCAGGGTTAACCCTAGG - Intronic
920295900 1:204956159-204956181 GCCACCATCAGTTTTTCCCTGGG + Intronic
922181137 1:223233782-223233804 GCCACCCACAGGTTTTCCCTGGG - Intronic
1063055500 10:2500081-2500103 AACACCCGCGGTCTTTCCCTTGG + Intergenic
1063102831 10:2965334-2965356 TGCAGCCCCAGTTCTTCCCTGGG - Intergenic
1072630300 10:97140748-97140770 GGCACCTCTGGTTTTGCCCAGGG + Intronic
1074466786 10:113690929-113690951 GGCACACCCAGTTTTTACCCAGG - Intronic
1080058412 11:27931636-27931658 AGCACCTCCTGTTTTTCCCAGGG + Intergenic
1080451076 11:32379448-32379470 GGCACCCCCAGATGTACCCTCGG + Intergenic
1083504108 11:63139250-63139272 GGCACCTTCTGTTTTTCCCAAGG - Intronic
1084878606 11:72153274-72153296 GGCACCTCCTGTTTTTCCCAGGG + Intergenic
1084890909 11:72236692-72236714 GTCACCCCGGTTTTATCCCTAGG + Intronic
1086603000 11:88658396-88658418 GGCATCCATGGTTTTTCCCACGG + Intronic
1088481042 11:110296630-110296652 GGCAGCCCCGCCTTTTCCCGCGG - Exonic
1089130457 11:116208124-116208146 GGCACCCCTGCTTCTTCCCCTGG - Intergenic
1094431333 12:30373109-30373131 AGCACCTCCTGTTTTTCCCAAGG + Intergenic
1095187480 12:39217618-39217640 GGCAACCCCTCTTATTCCCTAGG + Intergenic
1105274665 13:18908597-18908619 GGCACCTTCTGTTTTTCCCATGG - Intergenic
1106164990 13:27236758-27236780 GACAACCCCGGTTTTCCTCTGGG + Intergenic
1110049902 13:70883737-70883759 GGCACCTCCTGTTTTTACCAAGG - Intergenic
1113979932 13:114266278-114266300 GGCACCCTCTGGTTTTCCCAAGG + Intronic
1119597109 14:75945028-75945050 TTCTCCCCTGGTTTTTCCCTTGG - Intronic
1120855488 14:89208293-89208315 GGCATCCGCGCTTATTCCCTGGG + Intronic
1121224784 14:92313410-92313432 GTCACCCCCAGTTTCTTCCTTGG + Intergenic
1121578831 14:95011101-95011123 GGCGCCTCGGGCTTTTCCCTAGG - Intergenic
1128650082 15:69404834-69404856 AGAACCCCCTGGTTTTCCCTAGG - Exonic
1129797237 15:78387173-78387195 GCCACCCCCTGTCTTTCCCCTGG + Intergenic
1132540322 16:505443-505465 GGCCTCCCAGGTTGTTCCCTTGG + Intronic
1132725217 16:1335450-1335472 GGGACCCCCCGTCTTTCCCGTGG - Intronic
1135598722 16:23763494-23763516 GCCACCTCCAGTTTCTCCCTTGG - Intergenic
1137330606 16:47491845-47491867 GGCGCCCCGTGTTTTTCCCAAGG + Intronic
1137847652 16:51707797-51707819 CGCTCCCGCGGTTTTTCCCCTGG + Intergenic
1141242128 16:82274019-82274041 GCCTCCACAGGTTTTTCCCTTGG - Intergenic
1144664337 17:17091701-17091723 TGCACCCTCGGTTTTTCCTGAGG - Intronic
1151570514 17:74923319-74923341 GCCGCCCCCGGTCTTCCCCTGGG + Intergenic
1151969248 17:77449461-77449483 GGCCCCCCAGGCTTTTCCCAGGG - Intronic
1152034425 17:77863462-77863484 GGCTCACTGGGTTTTTCCCTTGG + Intergenic
1152892849 17:82892228-82892250 GCCACCCCGGATGTTTCCCTGGG + Intronic
1153285124 18:3449885-3449907 AGCGCCCCAGGTTTCTCCCTTGG - Intronic
1154466351 18:14645855-14645877 GGCACCTTCTGTTTTTCCCATGG - Intergenic
1157453850 18:47809048-47809070 GGCACCATTGGTTTTTCACTAGG - Exonic
1157856559 18:51110273-51110295 GGCACCCCGGCTCTTTCCCAGGG - Intergenic
1163440875 19:17322075-17322097 GGCACTCCCGCCTTTCCCCTCGG + Exonic
928672293 2:33614005-33614027 GGTACCTCCTGTTTTTCCCCAGG - Intergenic
929618768 2:43334053-43334075 GGCAATCCCAGTTCTTCCCTAGG - Intronic
932418948 2:71590183-71590205 GGCACCTCTGTTTTTTCCCTTGG + Intronic
933161419 2:79028128-79028150 GGCATCCCAGGTTTTAGCCTAGG - Intronic
933374659 2:81464151-81464173 GGCACCTCCCGTTTCTCTCTTGG - Intergenic
937463615 2:122110440-122110462 GGCCCCCCCAGATCTTCCCTTGG - Intergenic
939569397 2:143822615-143822637 GGCATCCCAGGTACTTCCCTGGG + Intergenic
941639590 2:167972757-167972779 GGCACCTCCTGTTTTTCCCAAGG - Intronic
942017454 2:171831219-171831241 GGCACCTTCTGTTTTTCCCAAGG - Intronic
949060499 2:241953801-241953823 GGCACCTCCGGCTCCTCCCTGGG - Intergenic
1173796359 20:45863355-45863377 GGCACCCTGGGTTTTTCCTTTGG - Intronic
1175913028 20:62413684-62413706 GGCAGCCTCGCTTTCTCCCTGGG + Intronic
1176808236 21:13512746-13512768 GGCACCTTCTGTTTTTCCCATGG + Intergenic
1182686704 22:32126346-32126368 GGCACCTTCTGTTTTTCCCAAGG - Intergenic
1182714903 22:32350119-32350141 GGCACCTTCTGTTTTTCCCAAGG + Intergenic
950119289 3:10471014-10471036 GGCAGCCCTGGTTGTTCTCTGGG + Intronic
961509827 3:127394013-127394035 GGCACCCCCCGGTTATCACTGGG - Intergenic
981543508 4:145870897-145870919 TGCACCCCAGGTTTTTGCTTTGG - Intronic
988439868 5:31220794-31220816 CCCACCCCCAGTTTTTCTCTTGG - Intronic
989113658 5:37930943-37930965 CGCACCCCCCTTCTTTCCCTAGG - Intergenic
991478602 5:67051150-67051172 GACATCACCTGTTTTTCCCTTGG + Intronic
1001095906 5:168775360-168775382 GACACACCAGATTTTTCCCTAGG + Intronic
1004440013 6:15641363-15641385 TGCACCCCAGCTTCTTCCCTTGG - Intronic
1007506232 6:42337407-42337429 GGCCCCTGCGGTTTTTCTCTGGG + Intronic
1013081233 6:106815236-106815258 GGCACCTCCTGTTTCTCCCAAGG - Intergenic
1015377526 6:132527691-132527713 GGCACCTCCTGTTTTTCCCAAGG - Intergenic
1019456483 7:1130367-1130389 GCCACCCCAGGTTGTTCCTTAGG - Intronic
1020350548 7:7214279-7214301 GGCATCTCCTGTTTTTCCCAAGG + Intronic
1021605673 7:22406875-22406897 TGCAGCCTTGGTTTTTCCCTTGG - Intergenic
1027198525 7:76047939-76047961 GGCAACCCCGGTGTTTGGCTGGG - Exonic
1029147822 7:98459079-98459101 CTCATCCCCGGTTTTGCCCTAGG - Intergenic
1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG + Intronic
1034900018 7:154902365-154902387 GGAACCCCCAGTTTTTAACTGGG + Intergenic
1042961289 8:74306403-74306425 GGCACCCCCCCTTTCTCCCATGG + Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1061873215 9:133531579-133531601 GGCCCCCTCGCTCTTTCCCTGGG + Intergenic
1191617246 X:63182428-63182450 GGCACCTCCTGTTTTTCCCAAGG - Intergenic
1191619052 X:63196495-63196517 GGCACCTCCTGTTTTTCCCAAGG + Intergenic
1194379909 X:93178950-93178972 GGCACCTCCTATTTTTCCCAAGG - Intergenic
1202061411 Y:20892333-20892355 GGCACCGTCTGTTTTTCCCAAGG - Intergenic