ID: 1033254150

View in Genome Browser
Species Human (GRCh38)
Location 7:139785026-139785048
Sequence GACTCAGGAATCTCTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033254139_1033254150 2 Left 1033254139 7:139785001-139785023 CCTCAGGCAGAACCCCAAACCCA 0: 1
1: 0
2: 2
3: 30
4: 342
Right 1033254150 7:139785026-139785048 GACTCAGGAATCTCTGGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 221
1033254141_1033254150 -10 Left 1033254141 7:139785013-139785035 CCCCAAACCCACTGACTCAGGAA 0: 1
1: 0
2: 7
3: 94
4: 629
Right 1033254150 7:139785026-139785048 GACTCAGGAATCTCTGGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033254150 Original CRISPR GACTCAGGAATCTCTGGGGG TGG Intronic
900390420 1:2431570-2431592 GACTCTGGAAGCTCTGGAGAAGG - Intronic
900988361 1:6086249-6086271 GTGTCAGGAATCCATGGGGGAGG - Intronic
901220754 1:7582427-7582449 GGCTCTGGATTCTCTGGGGTTGG + Intronic
902290548 1:15432061-15432083 TACTCAGGAAGCTCAGGAGGAGG + Intergenic
903353215 1:22730628-22730650 GGTTCAGGGATATCTGGGGGAGG + Intronic
903408268 1:23117493-23117515 CAATCAGGAAGCCCTGGGGGGGG + Intronic
903827517 1:26156547-26156569 CCCTCAGGGATCTCTGGTGGGGG - Intergenic
904108346 1:28105258-28105280 GGCTCAGGAATCTGAGTGGGAGG - Intergenic
904408131 1:30307211-30307233 GACTGGGGAGTCTCTGGGGAGGG - Intergenic
905275852 1:36817493-36817515 GAATCAGTAATTTCTGAGGGTGG + Intronic
907023034 1:51087117-51087139 GACACAGCAATCACTGGGAGGGG + Intergenic
907283500 1:53366032-53366054 GCCTCTGGAGTCTCTGAGGGAGG + Intergenic
907525437 1:55051250-55051272 GACTCAGGAGACCCTGGGGCAGG + Intronic
907552974 1:55319761-55319783 GATTCTGGAAACTTTGGGGGTGG + Intergenic
907846735 1:58215318-58215340 CCCTCAGGCATCTCTGAGGGAGG - Intronic
909702942 1:78547983-78548005 GACTCAGAAATCTCAGAGAGGGG - Intergenic
909931661 1:81504639-81504661 GACTCAGGGATCACGGGGGCGGG + Intronic
916410540 1:164542931-164542953 GACTCAGGAAGGGGTGGGGGTGG - Intergenic
916487192 1:165270380-165270402 GACTCAGGAAACTCCTGTGGGGG + Intronic
916652309 1:166843661-166843683 GACGCAGGGATCTCGGGGGAAGG - Intronic
923454065 1:234147840-234147862 CACTCAAGAGACTCTGGGGGTGG - Intronic
923503375 1:234584870-234584892 GACTCAGGGATATCTCTGGGTGG + Intergenic
1065921463 10:30397067-30397089 GACTCAGGATTCTCAGAGAGTGG + Intergenic
1067307348 10:45076768-45076790 GACTCAGGATTTTCTGGTTGTGG + Intergenic
1068753121 10:60619196-60619218 GACTCAAGACTCTTTGGGAGTGG - Intronic
1069884360 10:71614305-71614327 CACCCAGCAATCTCTGGGGTAGG - Intronic
1069889028 10:71641633-71641655 GAATCAGGAATTCCTGGGGGAGG + Intronic
1070817857 10:79336410-79336432 CACACAGCAATCTCTGGAGGAGG + Intergenic
1071900132 10:90111912-90111934 CACTTAGGAAGCTCTGGGGCAGG + Intergenic
1074578871 10:114697068-114697090 GACTCAGGGCACTCTGGGGGAGG + Intergenic
1075425409 10:122338274-122338296 GACTCAGGGTTCTGTGGGGCAGG - Intergenic
1075661175 10:124197492-124197514 CACTCAGACATCTCTGGGGAGGG + Intergenic
1075800460 10:125150485-125150507 GACACGGGAATGTCTGGGGATGG - Intronic
1076075905 10:127533671-127533693 TACTCAGGAGTGCCTGGGGGCGG - Intergenic
1077507913 11:2940704-2940726 GACTCATGGCTCTCTGAGGGTGG - Intergenic
1078454691 11:11465812-11465834 TACTCAGCTATCTCTAGGGGAGG + Intronic
1078643137 11:13114460-13114482 GACTGAGGTGACTCTGGGGGAGG - Intergenic
1079326185 11:19494668-19494690 GACTCAGGAAACCCGGGGTGGGG - Intronic
1079797771 11:24827712-24827734 GAATCAGTAATCTCTGAGGATGG + Intronic
1083421604 11:62556416-62556438 GACTCAGGCCTCCCTGGGGCAGG + Intergenic
1083474805 11:62908942-62908964 GACTGAGGCTTCTCTGGGGCAGG + Exonic
1084054328 11:66622341-66622363 TACTCAGGAGGCTCTGGGGCAGG - Intronic
1087204894 11:95384028-95384050 GACTCAGGAACGGCTGGGTGCGG + Intergenic
1087239792 11:95761943-95761965 GACTCAATAATCTCTGAGGATGG + Intergenic
1089242338 11:117092461-117092483 GACTAGAGAATCCCTGGGGGGGG - Intronic
1092911462 12:13148703-13148725 GACTAGGGAATCTCAGGAGGTGG - Intergenic
1093439628 12:19179042-19179064 GACTCAGGAATTTCTGAAAGAGG - Intronic
1095975440 12:47938050-47938072 GCCTCAGAGATCTCTGGGGATGG - Intronic
1098587287 12:72169313-72169335 GAATCAGAAACATCTGGGGGAGG - Intronic
1100106931 12:91186785-91186807 GACTGAGGAACCACTGTGGGAGG + Intergenic
1100189202 12:92172726-92172748 GACTTAGGACTGTCTGTGGGTGG - Intergenic
1100839850 12:98601475-98601497 GACTCTGGCATCTCGGGTGGAGG - Exonic
1101346011 12:103886685-103886707 GACTCAGGAACATCTGAGGCAGG + Intergenic
1103199086 12:119071836-119071858 GACTTTGAAATCTCTGAGGGTGG + Intronic
1104067202 12:125315872-125315894 GACTGAGGATGCTCTGGAGGTGG + Intronic
1104933612 12:132353158-132353180 GGCTCAGGAGGCTCTGAGGGAGG + Intergenic
1105990508 13:25615651-25615673 GTCTCAGGAATCCTTGGGGAGGG - Intronic
1106766249 13:32916734-32916756 GACTCAGTTCTCCCTGGGGGAGG - Intergenic
1108377073 13:49823672-49823694 GACTGAGGAGGCTCTGGGGAGGG - Intergenic
1110530314 13:76590033-76590055 GATTCATTAATATCTGGGGGTGG + Intergenic
1112041175 13:95550091-95550113 GAAGCCAGAATCTCTGGGGGTGG - Intronic
1112384505 13:98926061-98926083 TTCACAGGAATCTCTGGTGGTGG - Intronic
1112568432 13:100570947-100570969 GACTGAGCAATCTCTCGGGGAGG - Intronic
1114236584 14:20829088-20829110 ATCTCAGGAAACTCTGGTGGTGG - Intergenic
1114599389 14:23942127-23942149 GCCTCAGCACTCTCTGGGGCTGG - Intergenic
1114635297 14:24183777-24183799 GACTCAGAGATCTCAGGGTGCGG - Exonic
1118905399 14:70019718-70019740 GATTCCTGAAGCTCTGGGGGAGG + Intronic
1120204814 14:81576577-81576599 GACTCAAAAAACTCTGGGGTGGG - Intergenic
1121691621 14:95881773-95881795 GACTCTGGAATCTCTGGTCCTGG - Intergenic
1122140377 14:99659852-99659874 GGGTCAGGGATCTCCGGGGGGGG - Intronic
1123463750 15:20498052-20498074 GGCTAAGGAATCTATGGGGTCGG + Intergenic
1123654312 15:22502377-22502399 GGCTAAGGAATCTATGGGGTCGG - Intergenic
1124274598 15:28315422-28315444 GGCTAAGGAATCTATGGGGTCGG + Intronic
1124308220 15:28597571-28597593 GGCTAAGGAATCTATGGGGTCGG - Intergenic
1124634742 15:31357817-31357839 GGCTCGGGAGTCTCTGGCGGGGG - Intronic
1126785390 15:52174437-52174459 GAAGCAGGAAGCTCTGTGGGAGG + Intronic
1129295321 15:74596944-74596966 GACTCAGGGATCGCGGGGGCGGG + Exonic
1129904297 15:79175227-79175249 TACTCAGTCACCTCTGGGGGTGG - Intergenic
1130097225 15:80864865-80864887 GACTCAGAAAAATCTGAGGGTGG - Intronic
1130122291 15:81061450-81061472 GACTCATGAGTCTATGAGGGTGG + Intronic
1132957971 16:2606409-2606431 GACTGAGGAATCTGAGGAGGGGG + Intergenic
1132970447 16:2685657-2685679 GACTGAGGAATCTGAGGAGGGGG + Intronic
1134061966 16:11204759-11204781 GAGTCAGGGGTCTGTGGGGGAGG + Intergenic
1134536527 16:15030908-15030930 CATTCTAGAATCTCTGGGGGTGG - Intronic
1134596489 16:15500124-15500146 GACACAGGTATCTCTGTGGAGGG - Intronic
1136276346 16:29181358-29181380 GACACAGGAAGCTCTCGGGTGGG + Intergenic
1136578583 16:31138959-31138981 AACCCAGGAATCCTTGGGGGTGG - Exonic
1137353572 16:47735824-47735846 GACTCAGAAATCTCCAGGAGTGG - Intergenic
1142080729 16:88147418-88147440 GACACAGGAAGCTCTCGGGTGGG + Intergenic
1142977355 17:3653583-3653605 GTCTCAGGAAGCACTGGGTGCGG + Intronic
1145836018 17:27954949-27954971 AAATCAGGAATCCCTGGGGGTGG - Intergenic
1146278707 17:31531378-31531400 CACATTGGAATCTCTGGGGGTGG + Intronic
1148042319 17:44717915-44717937 TACTCAGGAGGCTCAGGGGGAGG + Intronic
1148051089 17:44770189-44770211 GACCCAGGAGGCTCTGAGGGTGG + Intronic
1148770013 17:50061148-50061170 CACTCTGGAATCTCTGAGGAGGG + Intronic
1151798972 17:76366298-76366320 GAATTAGGAATCTGAGGGGGTGG + Intronic
1152625255 17:81385162-81385184 GGAGCAGGAATCTCTGGGGAAGG + Intergenic
1153312087 18:3686810-3686832 AACTTATGTATCTCTGGGGGAGG - Intronic
1154062160 18:11072070-11072092 GACTAAGAAATCTCTGTTGGAGG - Intronic
1155104386 18:22647342-22647364 TACTCAGTAATTTTTGGGGGGGG - Intergenic
1155171291 18:23268463-23268485 AATTCTGGAATCTCTGAGGGTGG + Intronic
1156372160 18:36481239-36481261 GCCTCAGGAATTTCTGCAGGCGG + Intronic
1157758832 18:50243994-50244016 TAATTAGGAATTTCTGGGGGTGG - Intronic
1160414077 18:78695611-78695633 GTCTCACAAATCTCTAGGGGAGG + Intergenic
1160716042 19:577262-577284 TCCTCAGCAATCTCTGAGGGCGG - Intronic
1161614230 19:5261059-5261081 AAGGCGGGAATCTCTGGGGGTGG + Intronic
1162033538 19:7927350-7927372 GACCCAGGCAGCTCTGGGGGGGG + Intronic
1162344752 19:10112636-10112658 GCCTCAAGAATGTCTGGGTGTGG + Intronic
1163160558 19:15461556-15461578 GCCTCAGGGATCTGTGGGGTAGG + Exonic
1163641757 19:18466118-18466140 GACTCAGGCACCTATGCGGGTGG + Intronic
1165591391 19:36972869-36972891 GACTCTGGAAGCCCTGGCGGCGG + Intronic
1165929098 19:39344486-39344508 GTCTCAGGAAGCGCTGGGAGTGG - Intronic
1166758779 19:45211968-45211990 GACGCAGGAAAGTCTCGGGGTGG - Intronic
1167425224 19:49426719-49426741 GTCTCAGGAGACTCTGGGTGCGG - Exonic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168513194 19:56989826-56989848 TTCTCAGGACTCTCTGGGGTAGG + Intergenic
925827847 2:7867567-7867589 GACACAGGAATCTCTGGACTGGG - Intergenic
926607131 2:14908947-14908969 AATTTAGGAATCTCTGGGAGTGG - Intergenic
928198541 2:29232001-29232023 GAAGAAGGAATCTCAGGGGGAGG + Intronic
929503893 2:42513331-42513353 GATTCAGCAATCACTGGGGTGGG + Intronic
938943027 2:136186138-136186160 GACTGCGGAGTCTGTGGGGGAGG + Intergenic
940193095 2:151063290-151063312 GACAGAGGAATTTCTGGGGCTGG - Intergenic
943547686 2:189301075-189301097 TACTCAGGAAGCTGTGGTGGGGG + Intergenic
943811905 2:192196761-192196783 GATTCAGAAATCTTTGGAGGTGG - Intergenic
946246886 2:218392971-218392993 GCCTCAGGAAGCCCTGGGGTGGG - Exonic
946745403 2:222840338-222840360 GTTTCAGGTATCTCTGGGGTTGG - Intergenic
948431263 2:237920575-237920597 TACTCAGGAGGCTGTGGGGGAGG + Intergenic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1173066651 20:39719496-39719518 GACTCAGAAATCCTTGGGGTGGG + Intergenic
1173282785 20:41644158-41644180 GTCTCAGTAATCTTTGGGGCTGG - Intergenic
1173791796 20:45832883-45832905 TACTCAGAAACCTCTGAGGGAGG + Intronic
1173907385 20:46638801-46638823 GCCTGAGGATTCTCTGTGGGGGG + Intronic
1173954029 20:47016935-47016957 GACTCAGAAATGTCGGGTGGTGG + Intronic
1174259873 20:49286184-49286206 GATTCAGGATTATATGGGGGAGG + Intergenic
1174428292 20:50448891-50448913 GCCTTGGGAATATCTGGGGGCGG - Intergenic
1175855337 20:62118077-62118099 GGCTCAGGAATGGCTGGGGTGGG - Intergenic
1177225818 21:18254173-18254195 TAGTCAGGGATTTCTGGGGGTGG - Intronic
1177837603 21:26202370-26202392 TAATCAGGAATATTTGGGGGAGG + Intergenic
1178231564 21:30790941-30790963 GACTTAGGAATCCCGGGGGCTGG - Intergenic
1178397805 21:32258149-32258171 GACTCAGAAAGCATTGGGGGAGG + Intergenic
1182777261 22:32840077-32840099 GAAACAGGAATCTCTGGGCAGGG + Intronic
1183370033 22:37427130-37427152 GACCCAGGAGACACTGGGGGTGG + Intronic
1184129464 22:42509157-42509179 GCGCCAGGAATCTCTGGGAGGGG + Intergenic
1185371906 22:50464854-50464876 GACGCAGGACACGCTGGGGGTGG + Exonic
950124783 3:10504658-10504680 GCCTCAGGACTCCCTGAGGGTGG - Intronic
952081213 3:29759714-29759736 GACCCAGAAAGCTCTGGGGGGGG - Intronic
952743354 3:36756027-36756049 AACCCAGGAATCTTTTGGGGTGG - Intergenic
952872402 3:37912394-37912416 AATTAAGGAATCTCTGGGTGAGG + Intronic
960421122 3:117446899-117446921 GACAAAGAAAACTCTGGGGGAGG + Intergenic
961280794 3:125765044-125765066 TGCTCAGGAATCACTGGTGGGGG - Intergenic
964043148 3:152288353-152288375 GACTCAGGAATGACTGCGAGTGG + Intronic
964489585 3:157221209-157221231 GGCTCAGGAATCTTTGAGGAGGG + Intergenic
964986132 3:162741852-162741874 CACTCTGGATTATCTGGGGGTGG + Intergenic
965157055 3:165074655-165074677 GAATCACTAATTTCTGGGGGAGG + Exonic
967740384 3:192997256-192997278 GACTCAGCAATGCCTGGGGTTGG - Intergenic
968291579 3:197543480-197543502 GACTCTGGCATCCCTGGGGCAGG - Intronic
968341191 3:197957298-197957320 GACAGAGGGACCTCTGGGGGAGG - Intronic
968835940 4:2964150-2964172 GATTCGGGGTTCTCTGGGGGGGG - Intronic
969460694 4:7327251-7327273 GAGTCAGGAGGCTTTGGGGGAGG + Intronic
970370018 4:15396851-15396873 GACACAGGCAACTCAGGGGGTGG + Intronic
971812528 4:31444997-31445019 GATACAGGCATCTCTGGAGGGGG + Intergenic
971863684 4:32141485-32141507 GACCCAGCAATCTCTGGCGAAGG - Intergenic
973257468 4:48127894-48127916 CACCCAGGAACCTCTGGGGGTGG - Intronic
975714431 4:77191847-77191869 GCCTCTGGAAACTCTGGGGAAGG + Intronic
976260496 4:83140670-83140692 GACTCAGGAATGGCTGCTGGAGG + Intergenic
981525973 4:145707427-145707449 AACTGAGCAATCTCTTGGGGTGG - Intronic
984038991 4:174705464-174705486 GACTGATGAATTTCTGGGGGAGG + Intronic
984847958 4:184123557-184123579 GTCTCAGAAATCTCTGGAAGTGG - Intronic
984849458 4:184141415-184141437 GCCTCAGGGATCTGTGGGGAAGG + Intronic
986367125 5:7043585-7043607 TGCTCTGGAATCTCTGGGGAAGG + Intergenic
990600100 5:57349673-57349695 GATTCAGAAATCTCTGAGAGTGG + Intergenic
991631544 5:68661183-68661205 GACTCAGTAATCTATGGGTAGGG + Intergenic
992260753 5:74967810-74967832 GACACAGCAGTGTCTGGGGGAGG - Intergenic
992299415 5:75363290-75363312 GAATCAGAAATCGCTGGGGCAGG - Intergenic
995250910 5:109992314-109992336 TACTGAGGAATCTCTAGGGTAGG - Intergenic
995859208 5:116624012-116624034 GACACAGGAATGACTGTGGGAGG - Intergenic
996525649 5:124476575-124476597 GAATCATGGATATCTGGGGGTGG - Intergenic
998483840 5:142485033-142485055 GAGGCAGGAAGCTCTGGGAGGGG - Intergenic
999315639 5:150582312-150582334 TACGCAGGAATGTCTGGGGAGGG + Intergenic
1000439626 5:161250081-161250103 GACTCAGGAATGCTTGGGGTTGG - Intergenic
1007725413 6:43913070-43913092 GCCTCAGGCAGCTGTGGGGGTGG + Intergenic
1008228986 6:48960064-48960086 GTCCCAGGCATCTATGGGGGAGG - Intergenic
1008365868 6:50678953-50678975 TACTCAGGAGGCTCAGGGGGAGG + Intergenic
1012958101 6:105592528-105592550 GACTCAGGCATCCCTGGGTAGGG - Intergenic
1013330100 6:109092091-109092113 GACTCAGGAATTTCCTGGGAAGG - Intronic
1014474271 6:121853578-121853600 TTCTCAGGCATCTCTGTGGGTGG - Intergenic
1014717664 6:124885539-124885561 GCCTCAATAATCTCTGTGGGTGG - Intergenic
1018678345 6:166242325-166242347 GGCTCAGGGACCTCTGAGGGCGG - Intergenic
1018705593 6:166461402-166461424 CTCTCAGGACTCTCTGGGTGGGG - Intronic
1018842097 6:167524665-167524687 GACACAGGAAGCTCAGGGGGAGG - Intergenic
1021164075 7:17312226-17312248 GACTCCAGAATCTCTAAGGGTGG - Intronic
1022472496 7:30690471-30690493 GAATCAGGAATCTCAGGGTTGGG - Intronic
1022891863 7:34709172-34709194 TTCTCAGGAGTCCCTGGGGGAGG + Intronic
1026473471 7:70713928-70713950 GAATCAGAAATCACTGGAGGTGG - Intronic
1026847252 7:73705125-73705147 GAGTCAGGCTTGTCTGGGGGTGG - Intronic
1027639972 7:80720807-80720829 GACTCAGCAATCACTGAGGATGG + Intergenic
1027931055 7:84535725-84535747 GACACAGCAATCTCTGGAAGTGG - Intergenic
1028674356 7:93442009-93442031 TACTCAGGAAACTTTGGGGCAGG + Intronic
1030887999 7:114962580-114962602 GACATAAGAATCTCTGGAGGAGG + Intronic
1031019061 7:116607438-116607460 GACTCAGGCAATTATGGGGGCGG - Intergenic
1031331685 7:120473538-120473560 GACACAAGAATAGCTGGGGGTGG - Intronic
1033254150 7:139785026-139785048 GACTCAGGAATCTCTGGGGGTGG + Intronic
1033437026 7:141342454-141342476 GAGTGAGGAATCTCTTGGGAGGG + Intronic
1033754500 7:144386900-144386922 CACTCTAGAATCTCTGTGGGTGG + Intergenic
1034277225 7:149829255-149829277 GACTGAGGAGACTGTGGGGGGGG - Intergenic
1034552900 7:151832581-151832603 CACTGAGGCATCTCTGGGGGGGG + Intronic
1034578973 7:152026073-152026095 GCCTCAGGAGACGCTGGGGGAGG - Intronic
1034725343 7:153330619-153330641 GGCTCAGGGAGCTCTGGGGGTGG + Intergenic
1035889935 8:3332366-3332388 GACTCAGAGATGTCTGGAGGTGG - Intronic
1036137963 8:6179663-6179685 GACTCAGAAATGCCTGGGGCTGG - Intergenic
1038679740 8:29655604-29655626 AACTCATGACTCCCTGGGGGAGG + Intergenic
1043131876 8:76472598-76472620 CACACAGGAATCTGTTGGGGAGG + Intergenic
1044919647 8:97155527-97155549 GACTCAGGAGGCAGTGGGGGAGG - Intergenic
1045173819 8:99698404-99698426 GTCTCATGAACCTCTGAGGGTGG - Intronic
1047339380 8:123966088-123966110 CACACAGGAAGCACTGGGGGAGG - Intronic
1048775289 8:137939124-137939146 GACTCAGGGTTCTTTGGGGTGGG + Intergenic
1050353136 9:4759426-4759448 GCCTCAGGCATCTCAGGGAGGGG - Intergenic
1050656921 9:7839050-7839072 AAATCAAGAAACTCTGGGGGTGG + Intronic
1051592327 9:18788945-18788967 GACTCAGGAATCTCTGAATAAGG - Intronic
1051727305 9:20101587-20101609 AACTCAGACATCTCTGGGGTGGG + Intergenic
1057821193 9:98332335-98332357 GAGTCAGGAAATTCTGGGGCAGG + Intronic
1058098048 9:100886102-100886124 GACTCAGGAGTCTGTGAGAGAGG + Intergenic
1059351059 9:113665348-113665370 CACTCAGGAAGCTCTGCAGGTGG - Intergenic
1060155849 9:121319171-121319193 GACACAGGAAGCAGTGGGGGTGG + Intronic
1061507022 9:131037137-131037159 GCCCCAGGACTCTCTGGTGGAGG - Intronic
1062546483 9:137065914-137065936 CACTCAGGCTTCCCTGGGGGAGG + Intronic
1185614896 X:1414832-1414854 CATCCAGGAACCTCTGGGGGAGG + Intronic
1190714703 X:53093719-53093741 GGCTTAGGAATCTCTGCAGGTGG + Intergenic
1193696015 X:84708321-84708343 GGCTGAGGAATCTTTGGTGGAGG + Intergenic
1195047267 X:101065402-101065424 GAATCAGGAAACTCTGGAGATGG - Intergenic
1197761700 X:130032625-130032647 GGGACAGGAATCACTGGGGGAGG - Intronic
1199601998 X:149546543-149546565 GATTCAGGAAACGCTGGGAGAGG - Intronic
1199648390 X:149932941-149932963 GATTCAGGAAACGCTGGGAGAGG + Intronic