ID: 1033254245

View in Genome Browser
Species Human (GRCh38)
Location 7:139785819-139785841
Sequence AAGCTGTGCAGCTATTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033254245 Original CRISPR AAGCTGTGCAGCTATTGCTT AGG (reversed) Intronic
900857347 1:5196653-5196675 ACACTCTGCAGGTATTGCTTTGG + Intergenic
905481252 1:38263692-38263714 AAGGTGGGCAGCTATGACTTTGG + Intergenic
909043561 1:70683030-70683052 AAGCTTTGCTCCTTTTGCTTTGG + Intergenic
909542260 1:76804152-76804174 ATGCTATGCAGCTATTGATCTGG + Intergenic
909999893 1:82329613-82329635 AAGAAGTGCAACTATTCCTTCGG - Intergenic
911430445 1:97778807-97778829 AAATTGAGCAGCTATTTCTTAGG - Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
912983881 1:114406002-114406024 AAACTGTTAAGCTATTGATTGGG + Intronic
913532210 1:119741349-119741371 GAGCTGGGCAGCAGTTGCTTCGG + Intronic
915160869 1:153919737-153919759 AAGCTGTCCACCTCTTGCTTGGG - Intronic
916659048 1:166904182-166904204 AAGATGGGGAGATATTGCTTAGG - Intergenic
924299410 1:242622145-242622167 AATATGGGAAGCTATTGCTTTGG + Intergenic
1063545491 10:6977004-6977026 AAGTTGTACAGCTATTGTATTGG + Intergenic
1065398205 10:25264547-25264569 TAGCTGGGCAGCTTTTGCTTGGG - Intronic
1069586476 10:69607356-69607378 GCGCTGTGCTGCTACTGCTTAGG - Intergenic
1078198803 11:9160809-9160831 AAGCTGTGGAGCTAGGGCATGGG - Exonic
1079612777 11:22453777-22453799 AATCTATGCAGTTATTTCTTGGG + Intergenic
1080390430 11:31841051-31841073 AAGGTCTGCCTCTATTGCTTAGG + Intronic
1081294476 11:41368777-41368799 AAGCTCTGCAGCAATTTTTTAGG + Intronic
1084757169 11:71246934-71246956 AAGCTGTACAGTCATTGCTGGGG - Intronic
1085965284 11:81515668-81515690 AAGCTGTGGGGCTTTTTCTTTGG + Intergenic
1086838335 11:91653598-91653620 ACAGTGTGCAGCTATTGCTAGGG + Intergenic
1095762130 12:45851470-45851492 CAGCTCAGCAGCTATTGGTTGGG + Exonic
1095789617 12:46150517-46150539 AGGCTGTTCAGCTGTTCCTTGGG + Intergenic
1101641743 12:106590513-106590535 AAGCTGTACCTCGATTGCTTGGG + Intronic
1101743143 12:107516953-107516975 AAGCTGGGCAGGTATTGCCTAGG + Intronic
1103268290 12:119649590-119649612 AAACTGAGCAACTGTTGCTTTGG + Intergenic
1107070672 13:36265393-36265415 AGGCTGTGCAGCCATTGATTTGG - Intronic
1107381548 13:39861955-39861977 AAACTGTGGAGCTATGCCTTTGG - Intergenic
1108131319 13:47303793-47303815 AAGTTCTTCAGCTCTTGCTTTGG + Intergenic
1109566896 13:64130376-64130398 ACACTGTGCAGCTGTTGCCTGGG - Intergenic
1112855083 13:103758836-103758858 AAGTTGTACAGCAAATGCTTTGG + Intergenic
1116351788 14:43872063-43872085 GAGCTGTGCAGCTTTTGGTTAGG + Intergenic
1117496759 14:56312992-56313014 CAGATGGGCATCTATTGCTTTGG - Intergenic
1118351716 14:64976866-64976888 CAGCTGTTCAGCTGTTGCTATGG - Intronic
1120280080 14:82428265-82428287 AAACTATGCAGTTATTTCTTTGG - Intergenic
1122320404 14:100852023-100852045 AAGCTGTGCTCCTACTGCTCCGG - Intergenic
1124784023 15:32662239-32662261 AAGCTCTGTACCTATTGTTTAGG + Intronic
1127382486 15:58442079-58442101 AAGCTGTGCAGCTAGGGCATAGG - Intronic
1127982174 15:64043231-64043253 AAACTGTTCAGCAATTTCTTTGG + Intronic
1128763908 15:70239192-70239214 AAGCCTTGCAGCTTCTGCTTGGG - Intergenic
1129494114 15:75960433-75960455 CAGCTGGGCATCTTTTGCTTGGG + Intronic
1132376579 15:101332172-101332194 CAGCTGTGCACCTATTGCCCAGG + Intronic
1132378589 15:101349381-101349403 AAGCTGGGCTGCTATTGGGTTGG - Intronic
1133087744 16:3378258-3378280 AGGCTGCACAGCTATTGTTTTGG - Intronic
1136668170 16:31832479-31832501 AAACTCTGCAGCTTTTGCTCAGG + Intergenic
1140654694 16:77127479-77127501 AAACAGAGCAGTTATTGCTTGGG - Intergenic
1142180965 16:88670012-88670034 ATGCTTTGCAGCTTTTGGTTTGG - Intergenic
1143729744 17:8874367-8874389 AAACTGTGCTGCTTCTGCTTTGG + Intergenic
1151546559 17:74796842-74796864 CAGCTGTGCTGCTAGTGCCTGGG - Intronic
1153112726 18:1611677-1611699 AAGCTGTGCCCCTACTGCCTTGG + Intergenic
1153545889 18:6204344-6204366 AAGCTCTGTGGCTACTGCTTGGG + Intronic
1153715123 18:7839637-7839659 AAGCTGTGGAGCTTGGGCTTAGG + Intronic
1168382340 19:55934533-55934555 AAGCTCTGCAAATATTGATTTGG + Intergenic
925406024 2:3605861-3605883 AGGCTGTGCAGCTCTGGCTGGGG + Intronic
927322166 2:21759524-21759546 AAGGTGTGGAGCTATGGATTTGG - Intergenic
928748635 2:34445365-34445387 GAGCTGTGCAGGAAATGCTTGGG - Intergenic
932215087 2:69961330-69961352 AAGCTGTGCAGCCAGAGGTTTGG + Exonic
937984097 2:127630859-127630881 AGGGTGTGCAGCTTTTCCTTGGG - Exonic
938218930 2:129548933-129548955 AAGCTCTGCAGCTATGGACTTGG + Intergenic
939466300 2:142561740-142561762 CAGCTGTCCAGCCATGGCTTTGG + Intergenic
940044702 2:149397215-149397237 TAGCTGGGCAGTTCTTGCTTGGG + Intronic
940503865 2:154527866-154527888 AAGCTGTGCAGCTTGGGTTTAGG + Intergenic
943472626 2:188313556-188313578 CAGCTGTGCTCCTTTTGCTTAGG + Intronic
944977962 2:205079014-205079036 AAGCTGGGCAGCCCTCGCTTGGG - Intronic
947269522 2:228318436-228318458 ATGCTGAGCACCTCTTGCTTTGG + Intergenic
948535448 2:238643062-238643084 AAGCCCTGCTGCTATTGTTTGGG + Intergenic
1171064392 20:21999781-21999803 CAGCAGTGCAGGTATTCCTTTGG - Intergenic
1175695077 20:61096891-61096913 AATCTGTCTAGCTATGGCTTTGG + Intergenic
1177911608 21:27040210-27040232 AAGCTGACCAACAATTGCTTGGG + Intergenic
1178671499 21:34595356-34595378 AAGCTGTGAAGCACTTTCTTAGG - Intronic
1182578417 22:31289554-31289576 CAGCTGTGCAGCCAGTGATTGGG - Exonic
949237530 3:1828071-1828093 AAGCAGTGCAGATATTTGTTTGG + Intergenic
952704642 3:36365093-36365115 AAGCTGACCAACAATTGCTTGGG + Intergenic
952705632 3:36374895-36374917 AAGCTGTGCAGCTAGTAGTTTGG + Intergenic
954080057 3:48208293-48208315 AAGCTGGGCTGCTAATGCTAGGG - Intergenic
954646513 3:52135012-52135034 AAGATGTGCAGCTGGTTCTTTGG - Intronic
957486608 3:80870547-80870569 CAGCTGTGCAGCTGCTGCTGTGG + Intergenic
959153950 3:102643184-102643206 AAGCTTTGCAGCATTTACTTAGG + Intergenic
960740964 3:120833068-120833090 GAGCTTTGCAGCTAATGATTTGG - Intergenic
962106472 3:132395657-132395679 AAGCTGTGCAGCTTGGGGTTAGG - Intergenic
963496301 3:146066462-146066484 CAGGAGTGCAGATATTGCTTCGG + Intergenic
964043615 3:152295368-152295390 AAGCAATGCAGATATTTCTTGGG + Intronic
968656910 4:1782656-1782678 GCGCTGGGCCGCTATTGCTTGGG - Intergenic
970626195 4:17886495-17886517 AAGCTGCCCAGATAATGCTTTGG + Intronic
972715628 4:41643155-41643177 AAGGTGGGCAGCCATTGCTTTGG + Intronic
972811441 4:42591471-42591493 AAGCTTTGCAGTTATGCCTTAGG + Intronic
973632707 4:52834338-52834360 AAGCTGTGCTGCTATTACCTAGG + Intergenic
974321807 4:60359610-60359632 AAGCAGATCAGCAATTGCTTAGG + Intergenic
975369556 4:73568687-73568709 AAGCTGTGCAGCCTATGGTTGGG + Intergenic
976451938 4:85200073-85200095 AAGCTGTGCAGCTTGGGGTTAGG + Intergenic
977026855 4:91830802-91830824 AAGCTGTGCAGTCTTGGCTTAGG + Intergenic
982410758 4:155074107-155074129 CAGCTATGTAGCTATTTCTTTGG - Intergenic
982726369 4:158910575-158910597 GTGCTGTGCAGGTATTTCTTAGG + Intronic
984043327 4:174765399-174765421 AATCTTTCCAGCTATTGCTGTGG + Intronic
984140260 4:175996931-175996953 AATCTTTGCAGCTTCTGCTTGGG + Intronic
986899429 5:12413372-12413394 AAACTGTGCAGCCTTGGCTTAGG + Intergenic
988951301 5:36264371-36264393 AAGCCGTGCAGATATGGGTTTGG - Intronic
990122597 5:52473469-52473491 AAGTTGAGCAGTTATTTCTTTGG - Intergenic
992273397 5:75089294-75089316 AAGCTGTTCAGCAACTGCTTGGG + Intronic
999429962 5:151517503-151517525 AAACTGTGCAGGGATTTCTTTGG + Intronic
1000101175 5:158018142-158018164 AAGCTCTGCAGCTAGAACTTGGG - Intergenic
1000159914 5:158587197-158587219 AAGCTGTGCAGCTTGGGGTTAGG + Intergenic
1001040791 5:168333699-168333721 AAGCTGTGCAGGTAAAGCCTGGG - Intronic
1005493966 6:26372811-26372833 GAGCTGAGCAGCTAAAGCTTGGG + Intronic
1006259951 6:32859394-32859416 ACCCTCTGCAGCTATTGCTCTGG + Exonic
1007457902 6:41994694-41994716 AAGCTGTGCATGTATGGCGTAGG + Intronic
1011090119 6:83588560-83588582 AAGCTGTGCAGCTGTGGCACAGG + Intronic
1011656470 6:89556367-89556389 AAGCTGGTCAGCTAGTTCTTGGG - Intronic
1016757779 6:147705749-147705771 CAGCTGTCCAGCTATTGATTTGG + Intronic
1017662071 6:156684692-156684714 CAGCTGGGCAGTTCTTGCTTGGG + Intergenic
1019820094 7:3236206-3236228 AAGCTGTCCAGCTTCTGCTTGGG + Intergenic
1020761145 7:12269467-12269489 TAGGTGTGCAGCTATGGCTTGGG - Intergenic
1024955927 7:54920460-54920482 TTGCTGTGAAGCTATTGTTTAGG - Intergenic
1027405262 7:77854199-77854221 AACTTGTGCAGGTACTGCTTTGG + Intronic
1027876928 7:83782722-83782744 ATGCTGTCCAGCACTTGCTTTGG - Intergenic
1028640685 7:93039433-93039455 AAGATCTGCAGCCATGGCTTGGG - Intergenic
1031092376 7:117374912-117374934 AAGCTGTTCTTTTATTGCTTAGG - Intronic
1033254245 7:139785819-139785841 AAGCTGTGCAGCTATTGCTTAGG - Intronic
1034507252 7:151502789-151502811 CTGCTGTGCAGCTATTTCTGGGG + Intronic
1037962836 8:23111780-23111802 AAGCTGTGCCTCTGTTGCTGTGG - Exonic
1040997785 8:53419271-53419293 AAGCTGTGCCTCAATTGCCTTGG - Intergenic
1044717934 8:95117991-95118013 AAGCTCGGCAGTTCTTGCTTGGG + Intergenic
1047033087 8:120904830-120904852 AAGATGTGCAGCTATAGCACTGG - Intergenic
1047094754 8:121612404-121612426 AGGATGTGCAGCTTTTTCTTAGG + Exonic
1047222811 8:122932133-122932155 AAGCTGAGCTGCTCTTTCTTGGG - Intronic
1047793473 8:128230410-128230432 AATCTGTGAAGATGTTGCTTTGG + Intergenic
1049147626 8:141013262-141013284 ATGCTGTGCAGCGATTCCTGGGG - Intergenic
1050957890 9:11687645-11687667 AAGCTATGCAGCTGGTGCCTGGG + Intergenic
1058375270 9:104315885-104315907 AATCTGCTCAGCTATTACTTAGG - Intergenic
1058780100 9:108324905-108324927 AAGCTGTGCAGCTTGGGGTTTGG - Intergenic
1058953107 9:109921918-109921940 AATCTTTGCAGCAATTACTTTGG - Intronic
1203435798 Un_GL000195v1:135908-135930 AAGCTTTGTTGCTTTTGCTTAGG - Intergenic
1186841756 X:13491657-13491679 AAGCCCTCCAGGTATTGCTTTGG - Intergenic
1189869962 X:45371264-45371286 AAGCTGTGCAGCTTGTGGCTGGG - Intergenic
1189908179 X:45783268-45783290 AAGCTGTGCAGCAGTGGCCTGGG + Intergenic
1189935899 X:46067742-46067764 AAGCTGTGCACCCTTGGCTTAGG + Intergenic
1190619852 X:52275706-52275728 AAGCTCTTCAGGCATTGCTTTGG + Intergenic
1190984121 X:55485178-55485200 CAGCTGTGAAGCTCTGGCTTTGG - Exonic
1194234281 X:91362633-91362655 AAGCTGTGCCTCTATCGCCTTGG - Intergenic
1195834954 X:109103383-109103405 AAGCTGTGCAACTAGGGATTAGG + Intergenic
1196250405 X:113453400-113453422 AACCTGATCAGCTATTGCTTGGG + Intergenic
1197013452 X:121594536-121594558 AAGCTTTACAGATGTTGCTTGGG + Intergenic
1199908395 X:152259432-152259454 GAGCTGTGCAGCTTTGGGTTAGG - Intronic